Incidental Mutation 'PIT4515001:Ift140'
ID556350
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Nameintraflagellar transport 140
SynonymsTce5, Wdtc2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4515001 (G1)
Quality Score191.009
Status Not validated
Chromosome17
Chromosomal Location25016091-25099495 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25086860 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 807 (N807S)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
Predicted Effect probably damaging
Transcript: ENSMUST00000024983
AA Change: N807S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: N807S

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000137386
AA Change: N807S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: N807S

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.0%
  • 10x: 86.0%
  • 20x: 75.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,111 R966* probably null Het
4932438A13Rik T A 3: 36,974,236 Y2351N probably damaging Het
Adam32 A T 8: 24,914,326 I221K possibly damaging Het
Adcy6 T C 15: 98,595,146 T880A probably benign Het
Agpat5 T A 8: 18,846,641 Y28N probably damaging Het
Atg2a A G 19: 6,253,585 I1125V probably damaging Het
B4galt6 A G 18: 20,688,467 Y335H probably benign Het
Bend3 A T 10: 43,510,634 E341V probably damaging Het
Ccdc136 T A 6: 29,417,226 V682E probably benign Het
Ccdc142 T C 6: 83,103,257 C394R probably benign Het
Cfap58 A G 19: 48,034,683 N845D probably benign Het
Col4a3 G A 1: 82,682,303 G890R unknown Het
Cyp1a2 C A 9: 57,681,959 V191L probably benign Het
Cyp51 A T 5: 4,099,122 probably null Het
Diras2 T C 13: 52,507,747 S175G possibly damaging Het
Dnah6 A G 6: 73,114,582 F2242S probably damaging Het
Erg T A 16: 95,409,760 N78Y probably benign Het
Fdft1 T A 14: 63,164,583 Q49L probably benign Het
Frem1 G T 4: 82,900,426 H2183Q probably damaging Het
Fut2 G A 7: 45,650,466 T294I probably damaging Het
Gabrb1 A C 5: 71,700,817 D62A probably damaging Het
Gbe1 T A 16: 70,441,116 Y263* probably null Het
Gimap6 T C 6: 48,702,568 D178G probably benign Het
Gm3106 T C 5: 94,220,972 M442T probably benign Het
Gm7682 A C 5: 94,446,835 K185Q probably benign Het
Gss T A 2: 155,578,341 T147S probably damaging Het
Hlcs A T 16: 94,267,416 V315E probably benign Het
Hoxa3 C T 6: 52,170,184 G363E unknown Het
Iglc1 T G 16: 19,061,951 D40A Het
Itga10 T A 3: 96,662,632 I1120N probably damaging Het
Jak3 T C 8: 71,679,642 V217A probably benign Het
Kank2 T G 9: 21,794,883 I280L probably benign Het
Kcnk1 G T 8: 126,025,342 G229V probably damaging Het
Kpna7 T C 5: 145,005,052 T143A probably benign Het
Letmd1 C T 15: 100,476,802 R310C probably damaging Het
Mga G A 2: 119,916,504 V379I probably damaging Het
Mto1 T A 9: 78,457,417 Y313N probably damaging Het
Muc5ac G A 7: 141,807,416 C1488Y probably damaging Het
Nde1 T A 16: 14,170,493 probably null Het
Nfatc3 T C 8: 106,079,203 S235P possibly damaging Het
Nup88 T C 11: 70,944,721 D602G probably benign Het
Olfr741 T A 14: 50,486,079 M207K probably benign Het
Olfr93 A C 17: 37,151,379 S198A probably benign Het
Pcnx G A 12: 81,991,787 C1309Y Het
Phldb1 A G 9: 44,715,960 I396T probably benign Het
Prss53 G A 7: 127,888,791 T173I probably benign Het
Ptpn11 C A 5: 121,164,554 D156Y probably damaging Het
Rfx8 A G 1: 39,690,105 Y167H probably benign Het
Rpsa T A 9: 120,131,148 I259N probably benign Het
Rrm2b G T 15: 37,946,804 D84E probably benign Het
Scgb2b19 A T 7: 33,279,611 probably null Het
Sik3 T C 9: 46,208,731 L706P probably damaging Het
Slc4a4 A T 5: 89,133,253 E426D probably damaging Het
Slc8a2 C A 7: 16,140,579 L251I possibly damaging Het
Taf6 T C 5: 138,182,242 K287E probably benign Het
Tiam1 G A 16: 89,860,242 T702I probably damaging Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tle2 A G 10: 81,587,130 Q454R possibly damaging Het
Tsc2 T C 17: 24,621,147 N425S probably benign Het
Utp3 A G 5: 88,554,705 D31G probably benign Het
Vmn1r173 A T 7: 23,702,486 R49* probably null Het
Ybx2 T A 11: 69,940,398 V273E probably benign Het
Zbtb22 G A 17: 33,918,698 A606T probably benign Het
Zcchc8 A T 5: 123,700,932 D514E probably benign Het
Zfy2 T A Y: 2,117,096 I244F probably benign Het
Zglp1 T C 9: 21,066,189 N110S probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 unclassified probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAGGCATGTGGTACCTAGTC -3'
(R):5'- ATGTGGCAAACCTTCCTCTCG -3'

Sequencing Primer
(F):5'- ATAGGCATGTGGTACCTAGTCTTCAG -3'
(R):5'- TGTCTGAAACTGGGACTACTCAC -3'
Posted On2019-06-07