Incidental Mutation 'PIT4576001:Mindy1'
ID 556364
Institutional Source Beutler Lab
Gene Symbol Mindy1
Ensembl Gene ENSMUSG00000038712
Gene Name MINDY lysine 48 deubiquitinase 1
Synonyms 4930504E06Rik, cI-40, NF-E2 inducible protein, 1810005H09Rik, Fam63a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4576001 (G1)
Quality Score 223.009
Status Not validated
Chromosome 3
Chromosomal Location 95281345-95296166 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95288069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 41 (A41V)
Ref Sequence ENSEMBL: ENSMUSP00000102805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039537] [ENSMUST00000107187] [ENSMUST00000143498] [ENSMUST00000168223]
AlphaFold Q76LS9
Predicted Effect probably benign
Transcript: ENSMUST00000039537
AA Change: A41V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043910
Gene: ENSMUSG00000038712
AA Change: A41V

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107187
AA Change: A41V

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102805
Gene: ENSMUSG00000038712
AA Change: A41V

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 266 7e-42 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 400 406 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143498
Predicted Effect probably benign
Transcript: ENSMUST00000168223
AA Change: A41V

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127839
Gene: ENSMUSG00000038712
AA Change: A41V

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 72.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,952,999 S73P probably damaging Het
5730596B20Rik G T 6: 52,179,469 V172F unknown Het
Brms1 A G 19: 5,046,201 K69E probably damaging Het
Calr4 A C 4: 109,235,856 Q44H possibly damaging Het
Dnmt1 G A 9: 20,911,775 T1242I probably benign Het
Dyrk3 A G 1: 131,130,181 V85A probably damaging Het
Eif2a T C 3: 58,545,553 Y250H probably damaging Het
Esco1 T C 18: 10,572,093 E749G probably damaging Het
Fat1 A G 8: 45,024,645 I2243V probably damaging Het
Gh A T 11: 106,300,833 F128I possibly damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm5415 T C 1: 32,546,472 E119G probably damaging Het
Gtpbp4 A G 13: 8,991,727 Y150H probably damaging Het
Hist1h2ak C A 13: 21,753,611 D73Y probably damaging Het
Itga8 A G 2: 12,230,092 S452P probably benign Het
Kcnma1 C T 14: 23,309,035 probably null Het
Macf1 T C 4: 123,473,321 E2549G probably benign Het
Mypn T A 10: 63,120,071 K1201M probably damaging Het
Ncor1 A G 11: 62,333,717 S906P probably damaging Het
Npy1r T C 8: 66,704,222 V98A probably benign Het
Pate2 A G 9: 35,670,593 Y61C probably damaging Het
Pfdn2 A G 1: 171,345,742 S11G unknown Het
Prdm1 T C 10: 44,458,508 M1V probably null Het
Prelp A G 1: 133,915,165 S81P possibly damaging Het
Prss12 T C 3: 123,487,115 V483A probably damaging Het
Prss43 G C 9: 110,827,887 V154L probably damaging Het
Ptpru G A 4: 131,802,544 R618* probably null Het
Rpa1 A G 11: 75,313,158 S288P probably damaging Het
Siglec1 A G 2: 131,078,161 F817L probably damaging Het
Skint6 T A 4: 113,053,367 S545C possibly damaging Het
Slit1 A T 19: 41,624,549 V844D possibly damaging Het
Suclg2 G T 6: 95,587,018 D195E possibly damaging Het
Tln1 G T 4: 43,539,998 A1537D probably damaging Het
Trpv2 A G 11: 62,581,201 D73G probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Usp19 T A 9: 108,492,732 probably null Het
Vmn2r112 T C 17: 22,614,931 F527L probably benign Het
Vmn2r93 T C 17: 18,313,211 V459A probably benign Het
Other mutations in Mindy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Mindy1 APN 3 95288390 missense probably damaging 1.00
IGL03380:Mindy1 APN 3 95291018 splice site probably benign
ANU18:Mindy1 UTSW 3 95288390 missense probably damaging 1.00
R4647:Mindy1 UTSW 3 95282743 unclassified probably benign
R5076:Mindy1 UTSW 3 95295399 missense probably benign 0.01
R5875:Mindy1 UTSW 3 95294814 missense probably damaging 0.98
R5938:Mindy1 UTSW 3 95293756 missense probably benign 0.18
R8112:Mindy1 UTSW 3 95294811 missense probably damaging 1.00
R8692:Mindy1 UTSW 3 95292276 missense probably damaging 1.00
R9356:Mindy1 UTSW 3 95295279 missense probably benign 0.20
R9357:Mindy1 UTSW 3 95295279 missense probably benign 0.20
R9358:Mindy1 UTSW 3 95295279 missense probably benign 0.20
X0028:Mindy1 UTSW 3 95294895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCAAGGTCTCTGAGGTC -3'
(R):5'- ACACAGTAGAAATCTAGCTCAGG -3'

Sequencing Primer
(F):5'- TGAGGTCTCAGAACACTTCACTC -3'
(R):5'- GCTCAGGCTGTTGGATCC -3'
Posted On 2019-06-07