Incidental Mutation 'PIT4576001:Prss12'
ID556365
Institutional Source Beutler Lab
Gene Symbol Prss12
Ensembl Gene ENSMUSG00000027978
Gene Nameprotease, serine 12 neurotrypsin (motopsin)
Synonymsmotopsin, Bssp-3
Accession Numbers

Genbank: NM_008939.2

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #PIT4576001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location123446913-123506597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123487115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 483 (V483A)
Ref Sequence ENSEMBL: ENSMUSP00000029603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029603]
Predicted Effect probably damaging
Transcript: ENSMUST00000029603
AA Change: V483A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029603
Gene: ENSMUSG00000027978
AA Change: V483A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 43 N/A INTRINSIC
low complexity region 45 64 N/A INTRINSIC
KR 83 159 2.07e-21 SMART
SR 166 266 4.68e-57 SMART
SR 273 372 9.67e-50 SMART
SR 386 486 3.55e-57 SMART
Tryp_SPc 516 755 6.38e-91 SMART
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. Studies in mouse suggest that the encoded enzyme may be involved in structural reorganizations associated with learning and memory. The enzyme is also expressed in Leydig cells in the testis, but its function in this tissue is unknown. Defects in this gene are a cause of mental retardation autosomal recessive type 1 (MRT1). [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display hypoactivity and increased anxiety. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,952,999 S73P probably damaging Het
5730596B20Rik G T 6: 52,179,469 V172F unknown Het
Brms1 A G 19: 5,046,201 K69E probably damaging Het
Calr4 A C 4: 109,235,856 Q44H possibly damaging Het
Dnmt1 G A 9: 20,911,775 T1242I probably benign Het
Dyrk3 A G 1: 131,130,181 V85A probably damaging Het
Eif2a T C 3: 58,545,553 Y250H probably damaging Het
Esco1 T C 18: 10,572,093 E749G probably damaging Het
Fat1 A G 8: 45,024,645 I2243V probably damaging Het
Gh A T 11: 106,300,833 F128I possibly damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm5415 T C 1: 32,546,472 E119G probably damaging Het
Gtpbp4 A G 13: 8,991,727 Y150H probably damaging Het
Hist1h2ak C A 13: 21,753,611 D73Y probably damaging Het
Itga8 A G 2: 12,230,092 S452P probably benign Het
Kcnma1 C T 14: 23,309,035 probably null Het
Macf1 T C 4: 123,473,321 E2549G probably benign Het
Mindy1 C T 3: 95,288,069 A41V probably benign Het
Mypn T A 10: 63,120,071 K1201M probably damaging Het
Ncor1 A G 11: 62,333,717 S906P probably damaging Het
Npy1r T C 8: 66,704,222 V98A probably benign Het
Pate2 A G 9: 35,670,593 Y61C probably damaging Het
Pfdn2 A G 1: 171,345,742 S11G unknown Het
Prdm1 T C 10: 44,458,508 M1V probably null Het
Prelp A G 1: 133,915,165 S81P possibly damaging Het
Prss43 G C 9: 110,827,887 V154L probably damaging Het
Ptpru G A 4: 131,802,544 R618* probably null Het
Rpa1 A G 11: 75,313,158 S288P probably damaging Het
Siglec1 A G 2: 131,078,161 F817L probably damaging Het
Skint6 T A 4: 113,053,367 S545C possibly damaging Het
Slit1 A T 19: 41,624,549 V844D possibly damaging Het
Suclg2 G T 6: 95,587,018 D195E possibly damaging Het
Tln1 G T 4: 43,539,998 A1537D probably damaging Het
Trpv2 A G 11: 62,581,201 D73G probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Usp19 T A 9: 108,492,732 probably null Het
Vmn2r112 T C 17: 22,614,931 F527L probably benign Het
Vmn2r93 T C 17: 18,313,211 V459A probably benign Het
Other mutations in Prss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prss12 APN 3 123486949 splice site probably benign
IGL01090:Prss12 APN 3 123482739 missense possibly damaging 0.85
IGL01609:Prss12 APN 3 123482834 missense probably damaging 1.00
IGL02406:Prss12 APN 3 123505474 missense possibly damaging 0.81
IGL02445:Prss12 APN 3 123487020 missense probably damaging 1.00
IGL02928:Prss12 APN 3 123487156 missense possibly damaging 0.51
IGL02970:Prss12 APN 3 123482762 missense probably benign 0.03
IGL03116:Prss12 APN 3 123506276 missense probably benign
IGL03149:Prss12 APN 3 123505387 missense probably benign 0.00
nerd UTSW 3 123447384 missense probably benign 0.31
twerp UTSW 3 123482774 missense probably damaging 1.00
F5426:Prss12 UTSW 3 123506472 missense probably damaging 1.00
P4717OSA:Prss12 UTSW 3 123447618 missense probably damaging 1.00
R0116:Prss12 UTSW 3 123482774 missense probably damaging 1.00
R0528:Prss12 UTSW 3 123482796 missense probably benign 0.00
R0762:Prss12 UTSW 3 123485504 missense probably damaging 1.00
R1051:Prss12 UTSW 3 123485525 missense probably null 0.99
R1916:Prss12 UTSW 3 123506495 missense probably benign 0.07
R2185:Prss12 UTSW 3 123487144 missense probably benign 0.01
R2389:Prss12 UTSW 3 123487021 missense possibly damaging 0.63
R2938:Prss12 UTSW 3 123486976 missense probably benign 0.00
R3118:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R3119:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R4080:Prss12 UTSW 3 123485485 missense probably benign 0.44
R4161:Prss12 UTSW 3 123485527 nonsense probably null
R4997:Prss12 UTSW 3 123447208 missense probably benign 0.01
R5291:Prss12 UTSW 3 123505463 missense probably damaging 0.98
R5597:Prss12 UTSW 3 123464740 missense probably benign 0.18
R5941:Prss12 UTSW 3 123505501 missense probably benign 0.01
R6005:Prss12 UTSW 3 123482768 missense probably benign 0.00
R6119:Prss12 UTSW 3 123489609 missense possibly damaging 0.64
R6430:Prss12 UTSW 3 123479594 missense probably damaging 1.00
R6492:Prss12 UTSW 3 123447399 missense probably benign
R6864:Prss12 UTSW 3 123447384 missense probably benign 0.31
R7334:Prss12 UTSW 3 123487131 missense probably benign
R7492:Prss12 UTSW 3 123482776 nonsense probably null
R7669:Prss12 UTSW 3 123447396 missense probably benign
R7898:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
R8206:Prss12 UTSW 3 123464962 splice site probably null
R8835:Prss12 UTSW 3 123491552 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATCTGAAGAGCACTCTGTTTCCAG -3'
(R):5'- AGACTGCAAGCTTCCAGGAG -3'

Sequencing Primer
(F):5'- AGGGGTCCTGCCAGAGC -3'
(R):5'- AAGCTTCCAGGAGCCCACTTG -3'
Posted On2019-06-07