Incidental Mutation 'PIT4576001:Rpa1'
ID 556385
Institutional Source Beutler Lab
Gene Symbol Rpa1
Ensembl Gene ENSMUSG00000000751
Gene Name replication protein A1
Synonyms Rpa, 5031405K23Rik, RP-A, RF-A, 70kDa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # PIT4576001 (G1)
Quality Score 194.009
Status Not validated
Chromosome 11
Chromosomal Location 75298166-75348324 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75313158 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 288 (S288P)
Ref Sequence ENSEMBL: ENSMUSP00000000767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000767] [ENSMUST00000092907]
AlphaFold Q8VEE4
Predicted Effect probably damaging
Transcript: ENSMUST00000000767
AA Change: S288P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000767
Gene: ENSMUSG00000000751
AA Change: S288P

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 93 7.2e-30 PFAM
low complexity region 145 175 N/A INTRINSIC
Pfam:tRNA_anti-codon 227 316 5e-13 PFAM
Pfam:REPA_OB_2 335 432 5e-37 PFAM
Pfam:Rep_fac-A_C 491 636 4.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092907
AA Change: S267P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090585
Gene: ENSMUSG00000000751
AA Change: S267P

DomainStartEndE-ValueType
Pfam:Rep-A_N 5 104 4.3e-35 PFAM
low complexity region 124 154 N/A INTRINSIC
Pfam:tRNA_anti-codon 206 295 8.4e-13 PFAM
SCOP:d1fgua2 308 435 8e-46 SMART
Pfam:Rep_fac-A_C 470 615 9.2e-56 PFAM
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.3%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before implantation and impaired cell proliferation. Heterozygous null mice display decreased survival, chromosomal instability, impaired double strand break repair, and develop lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,952,999 S73P probably damaging Het
5730596B20Rik G T 6: 52,179,469 V172F unknown Het
Brms1 A G 19: 5,046,201 K69E probably damaging Het
Calr4 A C 4: 109,235,856 Q44H possibly damaging Het
Dnmt1 G A 9: 20,911,775 T1242I probably benign Het
Dyrk3 A G 1: 131,130,181 V85A probably damaging Het
Eif2a T C 3: 58,545,553 Y250H probably damaging Het
Esco1 T C 18: 10,572,093 E749G probably damaging Het
Fat1 A G 8: 45,024,645 I2243V probably damaging Het
Gh A T 11: 106,300,833 F128I possibly damaging Het
Gm17669 TAA TAAA 18: 67,562,749 probably null Het
Gm5415 T C 1: 32,546,472 E119G probably damaging Het
Gtpbp4 A G 13: 8,991,727 Y150H probably damaging Het
Hist1h2ak C A 13: 21,753,611 D73Y probably damaging Het
Itga8 A G 2: 12,230,092 S452P probably benign Het
Kcnma1 C T 14: 23,309,035 probably null Het
Macf1 T C 4: 123,473,321 E2549G probably benign Het
Mindy1 C T 3: 95,288,069 A41V probably benign Het
Mypn T A 10: 63,120,071 K1201M probably damaging Het
Ncor1 A G 11: 62,333,717 S906P probably damaging Het
Npy1r T C 8: 66,704,222 V98A probably benign Het
Pate2 A G 9: 35,670,593 Y61C probably damaging Het
Pfdn2 A G 1: 171,345,742 S11G unknown Het
Prdm1 T C 10: 44,458,508 M1V probably null Het
Prelp A G 1: 133,915,165 S81P possibly damaging Het
Prss12 T C 3: 123,487,115 V483A probably damaging Het
Prss43 G C 9: 110,827,887 V154L probably damaging Het
Ptpru G A 4: 131,802,544 R618* probably null Het
Siglec1 A G 2: 131,078,161 F817L probably damaging Het
Skint6 T A 4: 113,053,367 S545C possibly damaging Het
Slit1 A T 19: 41,624,549 V844D possibly damaging Het
Suclg2 G T 6: 95,587,018 D195E possibly damaging Het
Tln1 G T 4: 43,539,998 A1537D probably damaging Het
Trpv2 A G 11: 62,581,201 D73G probably damaging Het
Ucp3 T C 7: 100,480,251 S98P probably benign Het
Usp19 T A 9: 108,492,732 probably null Het
Vmn2r112 T C 17: 22,614,931 F527L probably benign Het
Vmn2r93 T C 17: 18,313,211 V459A probably benign Het
Other mutations in Rpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rpa1 APN 11 75312315 missense probably damaging 1.00
IGL01347:Rpa1 APN 11 75307285 missense probably damaging 1.00
IGL02976:Rpa1 APN 11 75312802 missense probably damaging 0.99
IGL03169:Rpa1 APN 11 75301357 missense probably damaging 0.97
nonnae UTSW 11 75314895 missense probably damaging 1.00
R6762_Rpa1_753 UTSW 11 75340345 missense possibly damaging 0.89
FR4976:Rpa1 UTSW 11 75318519 small deletion probably benign
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0017:Rpa1 UTSW 11 75314861 missense probably null 1.00
R0126:Rpa1 UTSW 11 75318529 missense probably benign 0.00
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0240:Rpa1 UTSW 11 75328687 missense probably benign 0.01
R0465:Rpa1 UTSW 11 75313095 missense probably damaging 0.99
R0718:Rpa1 UTSW 11 75318401 splice site probably benign
R0973:Rpa1 UTSW 11 75312973 splice site probably null
R1055:Rpa1 UTSW 11 75302732 missense probably damaging 1.00
R1172:Rpa1 UTSW 11 75312393 missense probably damaging 1.00
R1642:Rpa1 UTSW 11 75312691 critical splice donor site probably null
R1883:Rpa1 UTSW 11 75318483 missense probably benign
R1975:Rpa1 UTSW 11 75306176 missense probably damaging 1.00
R5008:Rpa1 UTSW 11 75313299 critical splice donor site probably null
R5279:Rpa1 UTSW 11 75313344 missense probably damaging 0.96
R6083:Rpa1 UTSW 11 75314911 missense probably damaging 1.00
R6161:Rpa1 UTSW 11 75314895 missense probably damaging 1.00
R6187:Rpa1 UTSW 11 75310236 missense probably benign 0.00
R6762:Rpa1 UTSW 11 75340345 missense possibly damaging 0.89
R6828:Rpa1 UTSW 11 75314871 missense probably damaging 1.00
R7044:Rpa1 UTSW 11 75312802 missense probably damaging 0.99
R7331:Rpa1 UTSW 11 75313115 missense probably damaging 0.98
R7798:Rpa1 UTSW 11 75312809 missense probably damaging 0.96
R7890:Rpa1 UTSW 11 75307224 frame shift probably null
R7938:Rpa1 UTSW 11 75307224 frame shift probably null
R8116:Rpa1 UTSW 11 75302675 missense possibly damaging 0.90
R8258:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8259:Rpa1 UTSW 11 75302724 missense probably benign 0.03
R8837:Rpa1 UTSW 11 75313341 missense possibly damaging 0.70
R9169:Rpa1 UTSW 11 75310173 nonsense probably null
RF018:Rpa1 UTSW 11 75318517 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTACTAGTGCGTCTTTAGCC -3'
(R):5'- TCTGCAGGGTGAAATCAGAG -3'

Sequencing Primer
(F):5'- AGCCTTGCTCTCTAGGTCAC -3'
(R):5'- GAGCAAGTGGACAAGTTCTTTCCC -3'
Posted On 2019-06-07