Incidental Mutation 'PIT4544001:Adgrl2'
ID 556400
Institutional Source Beutler Lab
Gene Symbol Adgrl2
Ensembl Gene ENSMUSG00000028184
Gene Name adhesion G protein-coupled receptor L2
Synonyms Lphn2, Lphh1, Lec1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # PIT4544001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 148521219-148696191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 148596157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 60 (E60K)
Ref Sequence ENSEMBL: ENSMUSP00000143626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200154] [ENSMUST00000200543]
AlphaFold Q8JZZ7
Predicted Effect probably damaging
Transcript: ENSMUST00000106128
AA Change: E60K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.3e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 4.6e-69 PFAM
Pfam:Latrophilin 1128 1487 6.4e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195988
AA Change: E60K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.3e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.1e-66 PFAM
Pfam:Latrophilin 1119 1189 2.2e-28 PFAM
Pfam:Latrophilin 1184 1435 5.5e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196526
AA Change: E60K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 8.7e-24 PFAM
OLF 138 394 3.4e-142 SMART
HormR 465 530 2e-22 SMART
Pfam:GAIN 533 747 1.1e-54 PFAM
GPS 771 823 2.2e-27 SMART
Pfam:7tm_2 831 1067 6.5e-68 PFAM
Pfam:Latrophilin 1087 1158 9.9e-36 PFAM
low complexity region 1163 1173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197567
AA Change: E60K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 1.9e-26 PFAM
OLF 142 398 5.22e-140 SMART
HormR 469 534 3.14e-20 SMART
Pfam:GAIN 537 764 1.1e-58 PFAM
GPS 788 840 3.47e-25 SMART
Pfam:7tm_2 848 1108 6.4e-69 PFAM
Pfam:Latrophilin 1128 1487 2.8e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198779
AA Change: E60K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1084 1.8e-66 PFAM
Pfam:Latrophilin 1104 1452 7e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199059
AA Change: E60K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.3e-66 PFAM
Pfam:Latrophilin 1119 1467 7.1e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199238
AA Change: E60K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.4e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 469 534 2e-22 SMART
GPS 788 840 2.1e-27 SMART
Pfam:7tm_2 848 1099 8.4e-66 PFAM
Pfam:Latrophilin 1119 1478 1.6e-187 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199750
AA Change: E60K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.1e-23 PFAM
OLF 142 398 3.3e-142 SMART
HormR 403 468 1.9e-22 SMART
GPS 709 761 2.1e-27 SMART
Pfam:7tm_2 769 1005 1.6e-66 PFAM
Pfam:Latrophilin 1025 1095 2e-28 PFAM
Pfam:Latrophilin 1090 1341 4.9e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200154
AA Change: E60K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 2.5e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.2e-66 PFAM
Pfam:Latrophilin 1087 1123 2.2e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200543
AA Change: E60K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: E60K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Gal_Lectin 49 129 3.2e-23 PFAM
OLF 138 394 3.3e-142 SMART
HormR 465 530 2e-22 SMART
GPS 771 823 2.1e-27 SMART
Pfam:7tm_2 831 1067 1.7e-66 PFAM
Pfam:Latrophilin 1087 1157 2.1e-28 PFAM
Pfam:Latrophilin 1152 1403 5.3e-123 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,222,943 (GRCm39) D248G probably damaging Het
Abcc12 A T 8: 87,231,875 (GRCm39) M1358K possibly damaging Het
Aff3 C T 1: 38,249,443 (GRCm39) A555T probably benign Het
Aspn A T 13: 49,707,458 (GRCm39) K106* probably null Het
Atp8b3 A T 10: 80,366,420 (GRCm39) L281Q probably benign Het
Ccdc54 A T 16: 50,410,343 (GRCm39) C308S possibly damaging Het
Cpa1 T C 6: 30,641,857 (GRCm39) V227A probably benign Het
Dld G A 12: 31,385,556 (GRCm39) Q262* probably null Het
Eif4e3 A T 6: 99,609,314 (GRCm39) W161R probably damaging Het
Epha5 T A 5: 84,479,471 (GRCm39) T178S possibly damaging Het
Erbb2 A T 11: 98,311,865 (GRCm39) T134S probably benign Het
Golga3 A T 5: 110,336,556 (GRCm39) E358D possibly damaging Het
Gon7 A T 12: 102,720,409 (GRCm39) D74E probably benign Het
Hmcn2 A G 2: 31,318,262 (GRCm39) E3869G probably damaging Het
Ifit1bl1 C T 19: 34,571,415 (GRCm39) M347I possibly damaging Het
Ipo5 T A 14: 121,165,949 (GRCm39) D331E probably damaging Het
Mep1a C T 17: 43,793,178 (GRCm39) C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 (GRCm38) S196P probably damaging Het
Nudt21 A T 8: 94,746,225 (GRCm39) F158I unknown Het
Padi3 T C 4: 140,518,794 (GRCm39) T443A probably benign Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Phkb A G 8: 86,738,266 (GRCm39) I520V probably benign Het
Plxna1 A G 6: 89,334,411 (GRCm39) S73P probably benign Het
Rfk T C 19: 17,372,708 (GRCm39) S77P probably damaging Het
Sdk1 A G 5: 141,941,987 (GRCm39) N545S probably benign Het
Setd2 A G 9: 110,380,232 (GRCm39) N1349S probably damaging Het
Slc22a27 T A 19: 7,887,103 (GRCm39) Q262L probably damaging Het
Slc34a3 T C 2: 25,120,607 (GRCm39) D440G probably benign Het
Slc4a4 T C 5: 89,186,402 (GRCm39) L161P probably damaging Het
Stxbp5 A C 10: 9,693,048 (GRCm39) probably null Het
Tekt1 C T 11: 72,245,660 (GRCm39) R165H probably damaging Het
Tmpo T C 10: 90,997,976 (GRCm39) N604D probably benign Het
Trpm1 A T 7: 63,848,998 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,790,550 (GRCm39) H513Q probably damaging Het
Ubr4 A G 4: 139,129,871 (GRCm39) N664D possibly damaging Het
Usp37 G A 1: 74,509,738 (GRCm39) T477I possibly damaging Het
Zbtb11 T G 16: 55,818,556 (GRCm39) L660* probably null Het
Other mutations in Adgrl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Adgrl2 APN 3 148,571,244 (GRCm39) missense probably damaging 0.99
IGL00572:Adgrl2 APN 3 148,532,134 (GRCm39) missense probably damaging 1.00
IGL01624:Adgrl2 APN 3 148,542,163 (GRCm39) missense probably damaging 1.00
IGL01796:Adgrl2 APN 3 148,564,611 (GRCm39) missense probably damaging 1.00
IGL02380:Adgrl2 APN 3 148,534,125 (GRCm39) nonsense probably null
IGL02468:Adgrl2 APN 3 148,596,116 (GRCm39) missense probably damaging 1.00
IGL02708:Adgrl2 APN 3 148,532,161 (GRCm39) missense probably damaging 0.96
IGL02869:Adgrl2 APN 3 148,596,241 (GRCm39) missense probably damaging 1.00
IGL03248:Adgrl2 APN 3 148,523,036 (GRCm39) missense probably damaging 1.00
IGL03343:Adgrl2 APN 3 148,565,016 (GRCm39) missense probably damaging 0.98
P0157:Adgrl2 UTSW 3 148,564,699 (GRCm39) missense probably damaging 1.00
PIT4382001:Adgrl2 UTSW 3 148,522,934 (GRCm39) missense
R0165:Adgrl2 UTSW 3 148,558,499 (GRCm39) splice site probably benign
R0242:Adgrl2 UTSW 3 148,544,821 (GRCm39) splice site probably null
R0242:Adgrl2 UTSW 3 148,544,821 (GRCm39) splice site probably null
R0344:Adgrl2 UTSW 3 148,571,231 (GRCm39) splice site probably null
R0488:Adgrl2 UTSW 3 148,552,541 (GRCm39) missense probably damaging 1.00
R0542:Adgrl2 UTSW 3 148,564,854 (GRCm39) missense probably damaging 1.00
R0630:Adgrl2 UTSW 3 148,544,880 (GRCm39) missense probably damaging 0.98
R0674:Adgrl2 UTSW 3 148,543,315 (GRCm39) missense possibly damaging 0.91
R1401:Adgrl2 UTSW 3 148,528,617 (GRCm39) missense probably damaging 0.99
R1543:Adgrl2 UTSW 3 148,564,909 (GRCm39) missense probably damaging 1.00
R1575:Adgrl2 UTSW 3 148,558,398 (GRCm39) missense probably benign 0.17
R1645:Adgrl2 UTSW 3 148,571,244 (GRCm39) missense probably damaging 1.00
R1780:Adgrl2 UTSW 3 148,558,229 (GRCm39) missense probably damaging 1.00
R1992:Adgrl2 UTSW 3 148,522,880 (GRCm39) missense possibly damaging 0.89
R2014:Adgrl2 UTSW 3 148,532,111 (GRCm39) missense probably damaging 1.00
R2130:Adgrl2 UTSW 3 148,596,124 (GRCm39) missense probably damaging 0.99
R2131:Adgrl2 UTSW 3 148,596,124 (GRCm39) missense probably damaging 0.99
R2400:Adgrl2 UTSW 3 148,557,570 (GRCm39) missense probably damaging 1.00
R2997:Adgrl2 UTSW 3 148,523,285 (GRCm39) missense probably damaging 1.00
R3161:Adgrl2 UTSW 3 148,523,187 (GRCm39) missense probably damaging 1.00
R3416:Adgrl2 UTSW 3 148,564,965 (GRCm39) missense probably damaging 1.00
R3417:Adgrl2 UTSW 3 148,564,965 (GRCm39) missense probably damaging 1.00
R3551:Adgrl2 UTSW 3 148,564,599 (GRCm39) missense probably damaging 1.00
R3760:Adgrl2 UTSW 3 148,522,871 (GRCm39) missense probably damaging 1.00
R4355:Adgrl2 UTSW 3 148,544,788 (GRCm39) missense probably damaging 1.00
R4850:Adgrl2 UTSW 3 148,564,656 (GRCm39) missense probably damaging 1.00
R4911:Adgrl2 UTSW 3 148,596,099 (GRCm39) missense probably damaging 0.99
R4945:Adgrl2 UTSW 3 148,528,672 (GRCm39) missense probably damaging 0.99
R5313:Adgrl2 UTSW 3 148,529,349 (GRCm39) missense probably damaging 1.00
R5339:Adgrl2 UTSW 3 148,523,480 (GRCm39) missense probably benign 0.01
R5540:Adgrl2 UTSW 3 148,543,198 (GRCm39) critical splice donor site probably null
R5583:Adgrl2 UTSW 3 148,564,800 (GRCm39) missense probably damaging 1.00
R5890:Adgrl2 UTSW 3 148,564,811 (GRCm39) missense probably damaging 1.00
R6170:Adgrl2 UTSW 3 148,528,645 (GRCm39) missense probably damaging 1.00
R6197:Adgrl2 UTSW 3 148,564,578 (GRCm39) missense probably damaging 1.00
R6284:Adgrl2 UTSW 3 148,532,143 (GRCm39) missense probably damaging 1.00
R6877:Adgrl2 UTSW 3 148,522,922 (GRCm39) missense probably damaging 1.00
R7048:Adgrl2 UTSW 3 148,552,565 (GRCm39) missense probably damaging 1.00
R7205:Adgrl2 UTSW 3 148,564,585 (GRCm39) missense probably damaging 1.00
R7326:Adgrl2 UTSW 3 148,552,506 (GRCm39) missense probably benign 0.00
R7348:Adgrl2 UTSW 3 148,523,402 (GRCm39) missense
R7382:Adgrl2 UTSW 3 148,522,919 (GRCm39) missense
R7486:Adgrl2 UTSW 3 148,523,330 (GRCm39) missense
R7498:Adgrl2 UTSW 3 148,564,852 (GRCm39) nonsense probably null
R7644:Adgrl2 UTSW 3 148,544,789 (GRCm39) missense probably damaging 1.00
R7690:Adgrl2 UTSW 3 148,522,934 (GRCm39) missense
R7742:Adgrl2 UTSW 3 148,542,064 (GRCm39) missense probably damaging 1.00
R7745:Adgrl2 UTSW 3 148,542,094 (GRCm39) missense probably damaging 1.00
R8291:Adgrl2 UTSW 3 148,556,554 (GRCm39) missense possibly damaging 0.93
R8326:Adgrl2 UTSW 3 148,533,190 (GRCm39) missense
R8343:Adgrl2 UTSW 3 148,552,542 (GRCm39) missense probably damaging 1.00
R8344:Adgrl2 UTSW 3 148,565,161 (GRCm39) missense probably damaging 0.98
R8487:Adgrl2 UTSW 3 148,565,122 (GRCm39) missense probably benign 0.06
R8748:Adgrl2 UTSW 3 148,532,026 (GRCm39) missense
R8769:Adgrl2 UTSW 3 148,522,917 (GRCm39) missense
R8804:Adgrl2 UTSW 3 148,552,652 (GRCm39) missense probably damaging 1.00
R8911:Adgrl2 UTSW 3 148,558,163 (GRCm39) intron probably benign
R8943:Adgrl2 UTSW 3 148,534,119 (GRCm39) missense probably damaging 1.00
R8977:Adgrl2 UTSW 3 148,660,223 (GRCm39) missense probably null
R9030:Adgrl2 UTSW 3 148,544,761 (GRCm39) missense possibly damaging 0.74
R9105:Adgrl2 UTSW 3 148,543,289 (GRCm39) missense possibly damaging 0.82
R9427:Adgrl2 UTSW 3 148,526,068 (GRCm39) missense
R9471:Adgrl2 UTSW 3 148,558,365 (GRCm39) missense probably benign
R9646:Adgrl2 UTSW 3 148,544,926 (GRCm39) missense probably damaging 0.96
R9742:Adgrl2 UTSW 3 148,541,986 (GRCm39) critical splice donor site probably null
RF007:Adgrl2 UTSW 3 148,544,884 (GRCm39) missense probably damaging 1.00
X0009:Adgrl2 UTSW 3 148,558,290 (GRCm39) missense probably damaging 1.00
X0019:Adgrl2 UTSW 3 148,571,230 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- CTAGACAAAAGCTTCGCTGAGG -3'
(R):5'- GATGCCTTGCTGAAACAATCTG -3'

Sequencing Primer
(F):5'- CTTGGGGCAGACAGAAACTTTAACC -3'
(R):5'- ATCTGTTTCATATGAGAGTGGAAGC -3'
Posted On 2019-06-07