Incidental Mutation 'PIT4544001:Cpa1'
ID556408
Institutional Source Beutler Lab
Gene Symbol Cpa1
Ensembl Gene ENSMUSG00000054446
Gene Namecarboxypeptidase A1, pancreatic
Synonyms0910001L12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4544001 (G1)
Quality Score187.009
Status Not validated
Chromosome6
Chromosomal Location30639218-30645363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30641858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000031806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031806]
Predicted Effect probably benign
Transcript: ENSMUST00000031806
AA Change: V227A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031806
Gene: ENSMUSG00000054446
AA Change: V227A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Propep_M14 26 100 1.6e-24 PFAM
Zn_pept 122 402 1.09e-132 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase A, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme. This gene is expressed in pancreas, the encoded protein is a major component of digestive enzymes secreted by pancreas and plays an important role in the process of digestion. This gene is located in a cluster of related carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-in allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Aspn A T 13: 49,553,982 K106* probably null Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Ccdc54 A T 16: 50,589,980 C308S possibly damaging Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ifit1bl1 C T 19: 34,594,015 M347I possibly damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Nudt21 A T 8: 94,019,597 F158I unknown Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Stxbp5 A C 10: 9,817,304 probably null Het
Tekt1 C T 11: 72,354,834 R165H probably damaging Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubqln3 A C 7: 104,141,343 H513Q probably damaging Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Cpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cpa1 APN 6 30642969 missense probably benign 0.05
IGL01288:Cpa1 APN 6 30640583 missense probably damaging 1.00
IGL01402:Cpa1 APN 6 30645276 missense possibly damaging 0.83
IGL01504:Cpa1 APN 6 30640721 missense probably benign 0.00
IGL01980:Cpa1 APN 6 30641582 missense possibly damaging 0.78
IGL02885:Cpa1 APN 6 30645170 missense probably damaging 1.00
P0026:Cpa1 UTSW 6 30640906 missense probably damaging 0.96
R0398:Cpa1 UTSW 6 30645251 missense probably benign 0.00
R0403:Cpa1 UTSW 6 30641857 missense probably benign 0.15
R1117:Cpa1 UTSW 6 30645261 missense probably benign 0.16
R1548:Cpa1 UTSW 6 30642335 missense probably damaging 1.00
R1631:Cpa1 UTSW 6 30640924 missense probably damaging 1.00
R1780:Cpa1 UTSW 6 30643008 missense probably damaging 1.00
R2202:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2203:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2204:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R2205:Cpa1 UTSW 6 30641819 missense probably damaging 1.00
R4838:Cpa1 UTSW 6 30639516 missense possibly damaging 0.80
R5497:Cpa1 UTSW 6 30640730 missense probably benign 0.42
R6306:Cpa1 UTSW 6 30640954 missense probably damaging 1.00
R7062:Cpa1 UTSW 6 30640677 missense probably benign 0.03
R7085:Cpa1 UTSW 6 30643620 missense probably benign 0.10
R7564:Cpa1 UTSW 6 30641768 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCCTAGAAGCAATGCCCAC -3'
(R):5'- GTGTCTATGGAAATCGGGACTG -3'

Sequencing Primer
(F):5'- TAGAAGCAATGCCCACAAAGG -3'
(R):5'- TTGAGGACAATGTCAGCTCC -3'
Posted On2019-06-07