Incidental Mutation 'PIT4544001:Plxna1'
ID 556409
Institutional Source Beutler Lab
Gene Symbol Plxna1
Ensembl Gene ENSMUSG00000030084
Gene Name plexin A1
Synonyms NOV, PlexA1, Plxn1, 2600013D04Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.888) question?
Stock # PIT4544001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 89293295-89339595 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89334411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 73 (S73P)
Ref Sequence ENSEMBL: ENSMUSP00000063066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]
AlphaFold P70206
PDB Structure The Plexin A1 intracellular region in complex with Rac1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049845
AA Change: S73P

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: S73P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1316 1864 8.8e-263 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163139
AA Change: S73P

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: S73P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Sema 49 494 7.43e-126 SMART
PSI 512 562 6.4e-11 SMART
PSI 658 705 9.78e-7 SMART
low complexity region 759 772 N/A INTRINSIC
PSI 806 860 7.24e-10 SMART
IPT 861 957 3.2e-26 SMART
IPT 958 1043 1.59e-21 SMART
IPT 1045 1145 6.86e-26 SMART
IPT 1147 1242 1.64e-5 SMART
transmembrane domain 1243 1265 N/A INTRINSIC
Pfam:Plexin_cytopl 1315 1864 2.5e-264 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,222,943 (GRCm39) D248G probably damaging Het
Abcc12 A T 8: 87,231,875 (GRCm39) M1358K possibly damaging Het
Adgrl2 C T 3: 148,596,157 (GRCm39) E60K probably damaging Het
Aff3 C T 1: 38,249,443 (GRCm39) A555T probably benign Het
Aspn A T 13: 49,707,458 (GRCm39) K106* probably null Het
Atp8b3 A T 10: 80,366,420 (GRCm39) L281Q probably benign Het
Ccdc54 A T 16: 50,410,343 (GRCm39) C308S possibly damaging Het
Cpa1 T C 6: 30,641,857 (GRCm39) V227A probably benign Het
Dld G A 12: 31,385,556 (GRCm39) Q262* probably null Het
Eif4e3 A T 6: 99,609,314 (GRCm39) W161R probably damaging Het
Epha5 T A 5: 84,479,471 (GRCm39) T178S possibly damaging Het
Erbb2 A T 11: 98,311,865 (GRCm39) T134S probably benign Het
Golga3 A T 5: 110,336,556 (GRCm39) E358D possibly damaging Het
Gon7 A T 12: 102,720,409 (GRCm39) D74E probably benign Het
Hmcn2 A G 2: 31,318,262 (GRCm39) E3869G probably damaging Het
Ifit1bl1 C T 19: 34,571,415 (GRCm39) M347I possibly damaging Het
Ipo5 T A 14: 121,165,949 (GRCm39) D331E probably damaging Het
Mep1a C T 17: 43,793,178 (GRCm39) C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 (GRCm38) S196P probably damaging Het
Nudt21 A T 8: 94,746,225 (GRCm39) F158I unknown Het
Padi3 T C 4: 140,518,794 (GRCm39) T443A probably benign Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Phkb A G 8: 86,738,266 (GRCm39) I520V probably benign Het
Rfk T C 19: 17,372,708 (GRCm39) S77P probably damaging Het
Sdk1 A G 5: 141,941,987 (GRCm39) N545S probably benign Het
Setd2 A G 9: 110,380,232 (GRCm39) N1349S probably damaging Het
Slc22a27 T A 19: 7,887,103 (GRCm39) Q262L probably damaging Het
Slc34a3 T C 2: 25,120,607 (GRCm39) D440G probably benign Het
Slc4a4 T C 5: 89,186,402 (GRCm39) L161P probably damaging Het
Stxbp5 A C 10: 9,693,048 (GRCm39) probably null Het
Tekt1 C T 11: 72,245,660 (GRCm39) R165H probably damaging Het
Tmpo T C 10: 90,997,976 (GRCm39) N604D probably benign Het
Trpm1 A T 7: 63,848,998 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,790,550 (GRCm39) H513Q probably damaging Het
Ubr4 A G 4: 139,129,871 (GRCm39) N664D possibly damaging Het
Usp37 G A 1: 74,509,738 (GRCm39) T477I possibly damaging Het
Zbtb11 T G 16: 55,818,556 (GRCm39) L660* probably null Het
Other mutations in Plxna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Plxna1 APN 6 89,297,980 (GRCm39) missense probably damaging 1.00
IGL01358:Plxna1 APN 6 89,299,732 (GRCm39) missense probably damaging 1.00
IGL01475:Plxna1 APN 6 89,331,870 (GRCm39) missense possibly damaging 0.92
IGL01480:Plxna1 APN 6 89,321,078 (GRCm39) missense possibly damaging 0.70
IGL01585:Plxna1 APN 6 89,306,538 (GRCm39) critical splice donor site probably null
IGL01804:Plxna1 APN 6 89,306,628 (GRCm39) missense probably damaging 1.00
IGL01909:Plxna1 APN 6 89,309,066 (GRCm39) critical splice donor site probably null
IGL01989:Plxna1 APN 6 89,306,396 (GRCm39) nonsense probably null
IGL02015:Plxna1 APN 6 89,319,433 (GRCm39) missense probably damaging 1.00
IGL02023:Plxna1 APN 6 89,334,314 (GRCm39) missense possibly damaging 0.88
IGL02668:Plxna1 APN 6 89,334,251 (GRCm39) nonsense probably null
IGL02703:Plxna1 APN 6 89,333,925 (GRCm39) missense probably damaging 1.00
IGL02954:Plxna1 APN 6 89,301,649 (GRCm39) missense probably damaging 1.00
IGL03212:Plxna1 APN 6 89,308,885 (GRCm39) missense probably damaging 1.00
R0055:Plxna1 UTSW 6 89,306,721 (GRCm39) missense possibly damaging 0.94
R0055:Plxna1 UTSW 6 89,306,721 (GRCm39) missense possibly damaging 0.94
R0147:Plxna1 UTSW 6 89,297,692 (GRCm39) missense possibly damaging 0.95
R0149:Plxna1 UTSW 6 89,297,595 (GRCm39) missense probably null 0.95
R0166:Plxna1 UTSW 6 89,310,001 (GRCm39) missense probably damaging 1.00
R0200:Plxna1 UTSW 6 89,300,575 (GRCm39) missense probably damaging 1.00
R0415:Plxna1 UTSW 6 89,334,318 (GRCm39) missense probably benign 0.12
R0841:Plxna1 UTSW 6 89,309,186 (GRCm39) missense probably damaging 1.00
R1018:Plxna1 UTSW 6 89,319,942 (GRCm39) missense probably damaging 1.00
R1240:Plxna1 UTSW 6 89,298,032 (GRCm39) missense probably damaging 1.00
R1355:Plxna1 UTSW 6 89,297,748 (GRCm39) unclassified probably benign
R1700:Plxna1 UTSW 6 89,333,990 (GRCm39) missense probably damaging 1.00
R1776:Plxna1 UTSW 6 89,312,446 (GRCm39) missense probably benign 0.00
R1957:Plxna1 UTSW 6 89,308,273 (GRCm39) missense probably damaging 1.00
R2314:Plxna1 UTSW 6 89,301,298 (GRCm39) missense probably damaging 1.00
R2968:Plxna1 UTSW 6 89,319,590 (GRCm39) missense probably damaging 1.00
R3118:Plxna1 UTSW 6 89,333,958 (GRCm39) missense possibly damaging 0.89
R3522:Plxna1 UTSW 6 89,314,335 (GRCm39) critical splice acceptor site probably null
R3619:Plxna1 UTSW 6 89,334,435 (GRCm39) missense probably damaging 0.97
R3766:Plxna1 UTSW 6 89,311,757 (GRCm39) unclassified probably benign
R3847:Plxna1 UTSW 6 89,333,501 (GRCm39) missense probably damaging 1.00
R3849:Plxna1 UTSW 6 89,333,501 (GRCm39) missense probably damaging 1.00
R3872:Plxna1 UTSW 6 89,309,674 (GRCm39) nonsense probably null
R4555:Plxna1 UTSW 6 89,300,310 (GRCm39) missense probably damaging 0.99
R4709:Plxna1 UTSW 6 89,311,733 (GRCm39) missense possibly damaging 0.72
R4726:Plxna1 UTSW 6 89,299,798 (GRCm39) missense probably damaging 1.00
R4739:Plxna1 UTSW 6 89,309,657 (GRCm39) splice site probably null
R5053:Plxna1 UTSW 6 89,299,442 (GRCm39) missense probably damaging 1.00
R5221:Plxna1 UTSW 6 89,297,998 (GRCm39) missense probably damaging 1.00
R5449:Plxna1 UTSW 6 89,300,590 (GRCm39) missense probably damaging 1.00
R5480:Plxna1 UTSW 6 89,301,616 (GRCm39) missense probably damaging 1.00
R5575:Plxna1 UTSW 6 89,301,523 (GRCm39) missense possibly damaging 0.83
R5743:Plxna1 UTSW 6 89,333,511 (GRCm39) missense probably damaging 1.00
R5744:Plxna1 UTSW 6 89,311,664 (GRCm39) missense possibly damaging 0.67
R5754:Plxna1 UTSW 6 89,310,087 (GRCm39) missense possibly damaging 0.96
R5868:Plxna1 UTSW 6 89,299,704 (GRCm39) splice site probably benign
R5988:Plxna1 UTSW 6 89,334,522 (GRCm39) nonsense probably null
R6190:Plxna1 UTSW 6 89,333,586 (GRCm39) nonsense probably null
R6425:Plxna1 UTSW 6 89,311,647 (GRCm39) missense probably benign 0.00
R6561:Plxna1 UTSW 6 89,333,960 (GRCm39) missense probably damaging 1.00
R6623:Plxna1 UTSW 6 89,299,753 (GRCm39) missense probably damaging 1.00
R6638:Plxna1 UTSW 6 89,301,382 (GRCm39) missense probably damaging 0.97
R6701:Plxna1 UTSW 6 89,296,430 (GRCm39) missense probably damaging 0.99
R6825:Plxna1 UTSW 6 89,297,597 (GRCm39) missense probably benign 0.01
R6911:Plxna1 UTSW 6 89,297,956 (GRCm39) missense probably damaging 1.00
R7073:Plxna1 UTSW 6 89,334,311 (GRCm39) missense probably damaging 1.00
R7177:Plxna1 UTSW 6 89,300,311 (GRCm39) missense possibly damaging 0.50
R7235:Plxna1 UTSW 6 89,317,573 (GRCm39) missense probably damaging 0.97
R7419:Plxna1 UTSW 6 89,334,584 (GRCm39) missense unknown
R7511:Plxna1 UTSW 6 89,318,889 (GRCm39) missense possibly damaging 0.71
R7543:Plxna1 UTSW 6 89,299,837 (GRCm39) missense probably damaging 1.00
R7665:Plxna1 UTSW 6 89,301,520 (GRCm39) critical splice donor site probably null
R7678:Plxna1 UTSW 6 89,308,882 (GRCm39) missense probably damaging 0.99
R7748:Plxna1 UTSW 6 89,314,335 (GRCm39) critical splice acceptor site probably null
R7748:Plxna1 UTSW 6 89,314,334 (GRCm39) critical splice acceptor site probably null
R7877:Plxna1 UTSW 6 89,300,241 (GRCm39) missense probably damaging 0.99
R8025:Plxna1 UTSW 6 89,308,254 (GRCm39) missense probably damaging 1.00
R8171:Plxna1 UTSW 6 89,334,102 (GRCm39) missense probably benign 0.20
R8277:Plxna1 UTSW 6 89,334,162 (GRCm39) missense probably damaging 1.00
R8782:Plxna1 UTSW 6 89,300,220 (GRCm39) missense probably damaging 1.00
R8867:Plxna1 UTSW 6 89,310,079 (GRCm39) missense probably benign 0.00
R9245:Plxna1 UTSW 6 89,314,320 (GRCm39) missense probably damaging 1.00
R9253:Plxna1 UTSW 6 89,334,522 (GRCm39) nonsense probably null
R9269:Plxna1 UTSW 6 89,306,541 (GRCm39) missense probably null 1.00
R9273:Plxna1 UTSW 6 89,296,364 (GRCm39) missense possibly damaging 0.77
R9281:Plxna1 UTSW 6 89,300,313 (GRCm39) missense probably damaging 1.00
R9368:Plxna1 UTSW 6 89,314,138 (GRCm39) missense probably benign
R9440:Plxna1 UTSW 6 89,318,912 (GRCm39) missense probably benign 0.00
R9526:Plxna1 UTSW 6 89,319,633 (GRCm39) missense probably benign
R9601:Plxna1 UTSW 6 89,308,253 (GRCm39) missense probably damaging 1.00
R9714:Plxna1 UTSW 6 89,296,440 (GRCm39) missense probably damaging 0.99
R9782:Plxna1 UTSW 6 89,333,817 (GRCm39) missense probably benign 0.01
S24628:Plxna1 UTSW 6 89,334,318 (GRCm39) missense probably benign 0.12
V8831:Plxna1 UTSW 6 89,334,119 (GRCm39) missense probably damaging 0.99
Z1176:Plxna1 UTSW 6 89,298,034 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATCGTCCAACCTCAGGAAC -3'
(R):5'- ACCTGAATACTTTGGCTTGAGGC -3'

Sequencing Primer
(F):5'- AGATGCCCTGTGAGGCACTG -3'
(R):5'- TCTGAGCTCTCGGACACTG -3'
Posted On 2019-06-07