Mutagenetix > Incidental Mutations

Incidental Mutation 'R0605:Adamts3'

55641

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

038794-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0605 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89861475 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 110 (W110R)

Ref Sequence

ENSEMBL: ENSMUSP00000058552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061427
AA Change: W110R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: W110R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163159
AA Change: W110R

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: W110R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196507

Predicted Effect

probably benign
Transcript: ENSMUST00000198151
AA Change: W110R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: W110R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	174	2.3e-29	PFAM

Meta Mutation Damage Score

0.8399

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

100% (85/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933406P04Rik	G	A	10: 20,311,227		probably benign	Het
Adam28	A	T	14: 68,606,600		probably benign	Het
Add1	T	C	5: 34,614,224	V342A	possibly damaging	Het
Aff3	A	G	1: 38,209,987	S680P	probably damaging	Het
Ak9	T	C	10: 41,345,139	Y322H	probably damaging	Het
Als2	A	G	1: 59,168,414	L1528S	probably benign	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atp6v1a	A	C	16: 44,111,496		probably null	Het
Bpi	T	C	2: 158,261,394	L103P	probably damaging	Het
Cd80	G	A	16: 38,482,694	V168I	probably benign	Het
Cfh	T	C	1: 140,102,358	S926G	probably damaging	Het
Chrd	A	T	16: 20,735,439	T304S	probably damaging	Het
Chsy3	A	G	18: 59,409,053	Y421C	probably damaging	Het
Cmbl	T	G	15: 31,585,309	V101G	probably damaging	Het
Colgalt2	T	A	1: 152,495,792		probably benign	Het
Coq4	C	T	2: 29,789,998	Q101*	probably null	Het
Cr2	T	C	1: 195,163,596		probably benign	Het
Cry1	T	C	10: 85,184,359	D38G	probably damaging	Het
Dmxl2	T	C	9: 54,419,945	D758G	probably benign	Het
Epsti1	C	T	14: 77,927,237		probably benign	Het
Fam24b	T	C	7: 131,327,186		probably benign	Het
Fem1c	G	A	18: 46,505,160	R592C	probably benign	Het
Foxred1	T	C	9: 35,204,882	Y490C	possibly damaging	Het
Gm14124	A	G	2: 150,268,603	I404M	unknown	Het
Gm9875	A	G	2: 13,557,888	K9R	unknown	Het
Grid2ip	T	C	5: 143,379,362	S322P	probably damaging	Het
Gucy1b2	A	G	14: 62,403,159		probably benign	Het
Hmcn1	A	T	1: 150,657,376		probably null	Het
Hpdl	C	T	4: 116,820,787	S159N	possibly damaging	Het
Hsd17b12	A	T	2: 94,033,642	M285K	probably benign	Het
Icam5	T	C	9: 21,032,197	I23T	probably benign	Het
Kat5	A	G	19: 5,608,336		probably benign	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lamb2	T	C	9: 108,486,105		probably benign	Het
Lgals3bp	A	G	11: 118,393,394	F453S	probably damaging	Het
Lypd4	A	G	7: 24,865,375	Y113H	probably damaging	Het
Mdm1	C	T	10: 118,146,601	T47M	probably damaging	Het
Mei1	C	A	15: 82,070,150	T52K	probably benign	Het
Meiob	G	A	17: 24,818,262		probably benign	Het
Ndufaf6	A	G	4: 11,051,224	V292A	probably damaging	Het
Neb	T	A	2: 52,264,026	M2358L	possibly damaging	Het
Nlrp1b	A	G	11: 71,156,179	S1119P	possibly damaging	Het
Nsmaf	A	G	4: 6,418,470		probably null	Het
Ogfod1	T	C	8: 94,047,267		probably benign	Het
Olfr1097	T	C	2: 86,890,419	Y252C	possibly damaging	Het
Olfr1410	G	T	1: 92,607,896	V20L	probably benign	Het
Olfr291	T	C	7: 84,857,137	I256T	probably damaging	Het
Osbpl1a	T	A	18: 12,882,279		probably null	Het
Otud7b	T	A	3: 96,144,959		probably benign	Het
P3h3	T	A	6: 124,856,035	H185L	probably damaging	Het
P4htm	G	A	9: 108,583,724	A183V	probably null	Het
Peak1	C	T	9: 56,227,098		probably benign	Het
Phf20l1	A	G	15: 66,595,122	K88R	probably damaging	Het
Phlpp2	A	G	8: 109,933,211	N721S	probably benign	Het
Plagl2	T	C	2: 153,235,944	K39R	probably benign	Het
Plppr1	A	T	4: 49,323,466	N252I	probably damaging	Het
Pom121l2	C	T	13: 21,982,036	A159V	probably damaging	Het
Prom2	C	A	2: 127,539,995		probably null	Het
Prrc2c	T	C	1: 162,682,426	T1017A	probably damaging	Het
Rimbp3	G	T	16: 17,211,699	A996S	probably damaging	Het
Rnf213	A	G	11: 119,431,717	T1387A	probably benign	Het
Scaper	A	T	9: 55,815,518		probably benign	Het
Scara5	A	G	14: 65,759,648	E403G	possibly damaging	Het
Scrib	T	C	15: 76,067,553	I94V	possibly damaging	Het
Shank3	T	C	15: 89,524,147	F67L	possibly damaging	Het
Shprh	T	C	10: 11,207,112	F1562L	probably damaging	Het
Src	C	T	2: 157,469,921	T529M	probably damaging	Het
Sycp2l	T	A	13: 41,143,466	M341K	probably benign	Het
Syde1	T	C	10: 78,589,095		probably benign	Het
Tarsl2	A	T	7: 65,678,071	R509S	probably damaging	Het
Tle6	T	A	10: 81,594,346	H324L	probably damaging	Het
Tnfaip8	ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	18: 50,046,845		probably benign	Het
Tnfrsf14	T	A	4: 154,925,380	K115*	probably null	Het
Trappc10	T	C	10: 78,201,497	N824S	possibly damaging	Het
Tsc1	C	T	2: 28,671,778	S309F	probably damaging	Het
Ttc21a	A	G	9: 119,961,842	I885V	possibly damaging	Het
Ttn	C	T	2: 76,740,453	A26699T	probably damaging	Het
Ttn	T	C	2: 76,948,371	Y1262C	unknown	Het
Usp49	T	C	17: 47,674,926		probably null	Het
Vmn1r226	A	T	17: 20,687,871	T122S	probably benign	Het
Vps8	A	T	16: 21,559,337	T1033S	probably benign	Het
Vwf	C	A	6: 125,685,837	T2728K	probably benign	Het
Wdr5b	T	C	16: 36,041,996	S162P	probably benign	Het
Xrn1	C	T	9: 96,026,877	Q1235*	probably null	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R7918:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7975:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	not run
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- AGGAGTCCTGCCAAACCCACTATG -3'
(R):5'- TGGTGACACCAGTTAGCACGAATC -3'

Sequencing Primer
(F):5'- CCACTATGCTGCCTATAGTTGAGG -3'
(R):5'- CCAGTTAGCACGAATCTAAAAGG -3'

Posted On

2013-07-11