Incidental Mutation 'R0605:Adamts3'
ID 55641
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0605 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90009334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 110 (W110R)
Ref Sequence ENSEMBL: ENSMUSP00000058552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]
AlphaFold E9Q287
Predicted Effect possibly damaging
Transcript: ENSMUST00000061427
AA Change: W110R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: W110R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: W110R

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: W110R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196507
Predicted Effect probably benign
Transcript: ENSMUST00000198151
AA Change: W110R

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: W110R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 174 2.3e-29 PFAM
Meta Mutation Damage Score 0.8399 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGAGTCCTGCCAAACCCACTATG -3'
(R):5'- TGGTGACACCAGTTAGCACGAATC -3'

Sequencing Primer
(F):5'- CCACTATGCTGCCTATAGTTGAGG -3'
(R):5'- CCAGTTAGCACGAATCTAAAAGG -3'
Posted On 2013-07-11