Incidental Mutation 'PIT4544001:Ubqln3'
ID 556412
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # PIT4544001 (G1)
Quality Score 185.009
Status Not validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 103790550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 513 (H513Q)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: H513Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: H513Q

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,222,943 (GRCm39) D248G probably damaging Het
Abcc12 A T 8: 87,231,875 (GRCm39) M1358K possibly damaging Het
Adgrl2 C T 3: 148,596,157 (GRCm39) E60K probably damaging Het
Aff3 C T 1: 38,249,443 (GRCm39) A555T probably benign Het
Aspn A T 13: 49,707,458 (GRCm39) K106* probably null Het
Atp8b3 A T 10: 80,366,420 (GRCm39) L281Q probably benign Het
Ccdc54 A T 16: 50,410,343 (GRCm39) C308S possibly damaging Het
Cpa1 T C 6: 30,641,857 (GRCm39) V227A probably benign Het
Dld G A 12: 31,385,556 (GRCm39) Q262* probably null Het
Eif4e3 A T 6: 99,609,314 (GRCm39) W161R probably damaging Het
Epha5 T A 5: 84,479,471 (GRCm39) T178S possibly damaging Het
Erbb2 A T 11: 98,311,865 (GRCm39) T134S probably benign Het
Golga3 A T 5: 110,336,556 (GRCm39) E358D possibly damaging Het
Gon7 A T 12: 102,720,409 (GRCm39) D74E probably benign Het
Hmcn2 A G 2: 31,318,262 (GRCm39) E3869G probably damaging Het
Ifit1bl1 C T 19: 34,571,415 (GRCm39) M347I possibly damaging Het
Ipo5 T A 14: 121,165,949 (GRCm39) D331E probably damaging Het
Mep1a C T 17: 43,793,178 (GRCm39) C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 (GRCm38) S196P probably damaging Het
Nudt21 A T 8: 94,746,225 (GRCm39) F158I unknown Het
Padi3 T C 4: 140,518,794 (GRCm39) T443A probably benign Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Phkb A G 8: 86,738,266 (GRCm39) I520V probably benign Het
Plxna1 A G 6: 89,334,411 (GRCm39) S73P probably benign Het
Rfk T C 19: 17,372,708 (GRCm39) S77P probably damaging Het
Sdk1 A G 5: 141,941,987 (GRCm39) N545S probably benign Het
Setd2 A G 9: 110,380,232 (GRCm39) N1349S probably damaging Het
Slc22a27 T A 19: 7,887,103 (GRCm39) Q262L probably damaging Het
Slc34a3 T C 2: 25,120,607 (GRCm39) D440G probably benign Het
Slc4a4 T C 5: 89,186,402 (GRCm39) L161P probably damaging Het
Stxbp5 A C 10: 9,693,048 (GRCm39) probably null Het
Tekt1 C T 11: 72,245,660 (GRCm39) R165H probably damaging Het
Tmpo T C 10: 90,997,976 (GRCm39) N604D probably benign Het
Trpm1 A T 7: 63,848,998 (GRCm39) probably benign Het
Ubr4 A G 4: 139,129,871 (GRCm39) N664D possibly damaging Het
Usp37 G A 1: 74,509,738 (GRCm39) T477I possibly damaging Het
Zbtb11 T G 16: 55,818,556 (GRCm39) L660* probably null Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTTGTGCTAGAGAAATCTGAG -3'
(R):5'- TGCCAACAGATCCTCGTTTG -3'

Sequencing Primer
(F):5'- GTCGGGGATCCTCAGACATAAC -3'
(R):5'- AACAGATCCTCGTTTGTTTCTACAC -3'
Posted On 2019-06-07