Incidental Mutation 'PIT4544001:Ubqln3'
ID556412
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Nameubiquilin 3
Synonyms4933400K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #PIT4544001 (G1)
Quality Score185.009
Status Not validated
Chromosome7
Chromosomal Location104140623-104143279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104141343 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 513 (H513Q)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: H513Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: H513Q

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Aspn A T 13: 49,553,982 K106* probably null Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Ccdc54 A T 16: 50,589,980 C308S possibly damaging Het
Cpa1 T C 6: 30,641,858 V227A probably benign Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ifit1bl1 C T 19: 34,594,015 M347I possibly damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Nudt21 A T 8: 94,019,597 F158I unknown Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Stxbp5 A C 10: 9,817,304 probably null Het
Tekt1 C T 11: 72,354,834 R165H probably damaging Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTTGTGCTAGAGAAATCTGAG -3'
(R):5'- TGCCAACAGATCCTCGTTTG -3'

Sequencing Primer
(F):5'- GTCGGGGATCCTCAGACATAAC -3'
(R):5'- AACAGATCCTCGTTTGTTTCTACAC -3'
Posted On2019-06-07