Incidental Mutation 'PIT4544001:Stxbp5'
ID556417
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4544001 (G1)
Quality Score171.009
Status Not validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 9817304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect probably null
Transcript: ENSMUST00000038213
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000125200
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000141722
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Aspn A T 13: 49,553,982 K106* probably null Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Ccdc54 A T 16: 50,589,980 C308S possibly damaging Het
Cpa1 T C 6: 30,641,858 V227A probably benign Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ifit1bl1 C T 19: 34,594,015 M347I possibly damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Nudt21 A T 8: 94,019,597 F158I unknown Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Tekt1 C T 11: 72,354,834 R165H probably damaging Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubqln3 A C 7: 104,141,343 H513Q probably damaging Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9769410 missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9808504 missense probably benign
R7974:Stxbp5 UTSW 10 9770695 splice site probably null
R8009:Stxbp5 UTSW 10 9816302 missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9784385 missense probably benign
R8353:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9812259 critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9812289 missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9817306 missense probably null 0.98
R8805:Stxbp5 UTSW 10 9838115 nonsense probably null
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9900545 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TATTGGACTCTCTGGAGAAATCAAG -3'
(R):5'- CCTTTGTGTTTTATTTCCAGGGAAC -3'

Sequencing Primer
(F):5'- CTCAGTGTCTGTCTTTGAATGATAG -3'
(R):5'- ACCTTTTATTATTTTGTCAGGAGGC -3'
Posted On2019-06-07