Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4544001:Atp8b3'

556418

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

PIT4544001 (G1)

Quality Score

106.008

Status

Not validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80530586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 281 (L281Q)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably benign
Transcript: ENSMUST00000020383
AA Change: L281Q

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: L281Q

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219648

Predicted Effect

probably benign
Transcript: ENSMUST00000220326
AA Change: L281Q

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 92.9%
3x: 90.6%
10x: 84.5%
20x: 71.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	A	G	16: 14,405,079	D248G	probably damaging	Het
Abcc12	A	T	8: 86,505,246	M1358K	possibly damaging	Het
Adgrl2	C	T	3: 148,890,521	E60K	probably damaging	Het
Aff3	C	T	1: 38,210,362	A555T	probably benign	Het
Aspn	A	T	13: 49,553,982	K106*	probably null	Het
Ccdc54	A	T	16: 50,589,980	C308S	possibly damaging	Het
Cpa1	T	C	6: 30,641,858	V227A	probably benign	Het
Dld	G	A	12: 31,335,557	Q262*	probably null	Het
Eif4e3	A	T	6: 99,632,353	W161R	probably damaging	Het
Epha5	T	A	5: 84,331,612	T178S	possibly damaging	Het
Erbb2	A	T	11: 98,421,039	T134S	probably benign	Het
Golga3	A	T	5: 110,188,690	E358D	possibly damaging	Het
Gon7	A	T	12: 102,754,150	D74E	probably benign	Het
Hmcn2	A	G	2: 31,428,250	E3869G	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,015	M347I	possibly damaging	Het
Ipo5	T	A	14: 120,928,537	D331E	probably damaging	Het
Mep1a	C	T	17: 43,482,287	C355Y	probably damaging	Het
Nkain1	A	G	4: 130,532,098	S196P	probably damaging	Het
Nudt21	A	T	8: 94,019,597	F158I	unknown	Het
Padi3	T	C	4: 140,791,483	T443A	probably benign	Het
Parpbp	A	G	10: 88,114,549	V323A	possibly damaging	Het
Phkb	A	G	8: 86,011,637	I520V	probably benign	Het
Plxna1	A	G	6: 89,357,429	S73P	probably benign	Het
Rfk	T	C	19: 17,395,344	S77P	probably damaging	Het
Sdk1	A	G	5: 141,956,232	N545S	probably benign	Het
Setd2	A	G	9: 110,551,164	N1349S	probably damaging	Het
Slc22a27	T	A	19: 7,909,738	Q262L	probably damaging	Het
Slc34a3	T	C	2: 25,230,595	D440G	probably benign	Het
Slc4a4	T	C	5: 89,038,543	L161P	probably damaging	Het
Stxbp5	A	C	10: 9,817,304		probably null	Het
Tekt1	C	T	11: 72,354,834	R165H	probably damaging	Het
Tmpo	T	C	10: 91,162,114	N604D	probably benign	Het
Trpm1	A	T	7: 64,199,250		probably benign	Het
Ubqln3	A	C	7: 104,141,343	H513Q	probably damaging	Het
Ubr4	A	G	4: 139,402,560	N664D	possibly damaging	Het
Usp37	G	A	1: 74,470,579	T477I	possibly damaging	Het
Zbtb11	T	G	16: 55,998,193	L660*	probably null	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9438:Atp8b3	UTSW	10	80525575	missense	probably damaging	1.00
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGGGAGCTCAAGGTTAGTCTG -3'
(R):5'- GCTAGTTGTCAGCACTCTGG -3'

Sequencing Primer
(F):5'- CTCAAGGTTAGTCTGCATATATGGC -3'
(R):5'- TCAGCACTCTGGTTATCATTGAG -3'

Posted On

2019-06-07