Incidental Mutation 'PIT4544001:Atp8b3'
ID 556418
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # PIT4544001 (G1)
Quality Score 106.008
Status Not validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80366420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 281 (L281Q)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000020383
AA Change: L281Q

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: L281Q

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Predicted Effect probably benign
Transcript: ENSMUST00000220326
AA Change: L281Q

PolyPhen 2 Score 0.372 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,222,943 (GRCm39) D248G probably damaging Het
Abcc12 A T 8: 87,231,875 (GRCm39) M1358K possibly damaging Het
Adgrl2 C T 3: 148,596,157 (GRCm39) E60K probably damaging Het
Aff3 C T 1: 38,249,443 (GRCm39) A555T probably benign Het
Aspn A T 13: 49,707,458 (GRCm39) K106* probably null Het
Ccdc54 A T 16: 50,410,343 (GRCm39) C308S possibly damaging Het
Cpa1 T C 6: 30,641,857 (GRCm39) V227A probably benign Het
Dld G A 12: 31,385,556 (GRCm39) Q262* probably null Het
Eif4e3 A T 6: 99,609,314 (GRCm39) W161R probably damaging Het
Epha5 T A 5: 84,479,471 (GRCm39) T178S possibly damaging Het
Erbb2 A T 11: 98,311,865 (GRCm39) T134S probably benign Het
Golga3 A T 5: 110,336,556 (GRCm39) E358D possibly damaging Het
Gon7 A T 12: 102,720,409 (GRCm39) D74E probably benign Het
Hmcn2 A G 2: 31,318,262 (GRCm39) E3869G probably damaging Het
Ifit1bl1 C T 19: 34,571,415 (GRCm39) M347I possibly damaging Het
Ipo5 T A 14: 121,165,949 (GRCm39) D331E probably damaging Het
Mep1a C T 17: 43,793,178 (GRCm39) C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 (GRCm38) S196P probably damaging Het
Nudt21 A T 8: 94,746,225 (GRCm39) F158I unknown Het
Padi3 T C 4: 140,518,794 (GRCm39) T443A probably benign Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Phkb A G 8: 86,738,266 (GRCm39) I520V probably benign Het
Plxna1 A G 6: 89,334,411 (GRCm39) S73P probably benign Het
Rfk T C 19: 17,372,708 (GRCm39) S77P probably damaging Het
Sdk1 A G 5: 141,941,987 (GRCm39) N545S probably benign Het
Setd2 A G 9: 110,380,232 (GRCm39) N1349S probably damaging Het
Slc22a27 T A 19: 7,887,103 (GRCm39) Q262L probably damaging Het
Slc34a3 T C 2: 25,120,607 (GRCm39) D440G probably benign Het
Slc4a4 T C 5: 89,186,402 (GRCm39) L161P probably damaging Het
Stxbp5 A C 10: 9,693,048 (GRCm39) probably null Het
Tekt1 C T 11: 72,245,660 (GRCm39) R165H probably damaging Het
Tmpo T C 10: 90,997,976 (GRCm39) N604D probably benign Het
Trpm1 A T 7: 63,848,998 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,790,550 (GRCm39) H513Q probably damaging Het
Ubr4 A G 4: 139,129,871 (GRCm39) N664D possibly damaging Het
Usp37 G A 1: 74,509,738 (GRCm39) T477I possibly damaging Het
Zbtb11 T G 16: 55,818,556 (GRCm39) L660* probably null Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9438:Atp8b3 UTSW 10 80,361,409 (GRCm39) missense probably damaging 1.00
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGGAGCTCAAGGTTAGTCTG -3'
(R):5'- GCTAGTTGTCAGCACTCTGG -3'

Sequencing Primer
(F):5'- CTCAAGGTTAGTCTGCATATATGGC -3'
(R):5'- TCAGCACTCTGGTTATCATTGAG -3'
Posted On 2019-06-07