Incidental Mutation 'PIT4544001:Tmpo'
ID 556420
Institutional Source Beutler Lab
Gene Symbol Tmpo
Ensembl Gene ENSMUSG00000019961
Gene Name thymopoietin
Synonyms TP, LAP2, lamina-associated polypeptide 2, 5630400D24Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4544001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 90983433-91017177 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90997976 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 604 (N604D)
Ref Sequence ENSEMBL: ENSMUSP00000020123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020123] [ENSMUST00000072239] [ENSMUST00000092219] [ENSMUST00000099355] [ENSMUST00000105293]
AlphaFold Q61033
PDB Structure THE DIMERIZATION DOMAIN OF LAP2ALPHA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000020123
AA Change: N604D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020123
Gene: ENSMUSG00000019961
AA Change: N604D

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 189 197 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Pfam:LAP2alpha 459 692 6.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072239
SMART Domains Protein: ENSMUSP00000072092
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 226 240 N/A INTRINSIC
transmembrane domain 410 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092219
SMART Domains Protein: ENSMUSP00000089864
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099355
SMART Domains Protein: ENSMUSP00000096956
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105293
SMART Domains Protein: ENSMUSP00000100930
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 301 320 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous null for a protein isoform generated from this locus have hyperproliferation of epidermal and erythroid progenitor cells that leads to thickened paws and increased crypt lengths in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,222,943 (GRCm39) D248G probably damaging Het
Abcc12 A T 8: 87,231,875 (GRCm39) M1358K possibly damaging Het
Adgrl2 C T 3: 148,596,157 (GRCm39) E60K probably damaging Het
Aff3 C T 1: 38,249,443 (GRCm39) A555T probably benign Het
Aspn A T 13: 49,707,458 (GRCm39) K106* probably null Het
Atp8b3 A T 10: 80,366,420 (GRCm39) L281Q probably benign Het
Ccdc54 A T 16: 50,410,343 (GRCm39) C308S possibly damaging Het
Cpa1 T C 6: 30,641,857 (GRCm39) V227A probably benign Het
Dld G A 12: 31,385,556 (GRCm39) Q262* probably null Het
Eif4e3 A T 6: 99,609,314 (GRCm39) W161R probably damaging Het
Epha5 T A 5: 84,479,471 (GRCm39) T178S possibly damaging Het
Erbb2 A T 11: 98,311,865 (GRCm39) T134S probably benign Het
Golga3 A T 5: 110,336,556 (GRCm39) E358D possibly damaging Het
Gon7 A T 12: 102,720,409 (GRCm39) D74E probably benign Het
Hmcn2 A G 2: 31,318,262 (GRCm39) E3869G probably damaging Het
Ifit1bl1 C T 19: 34,571,415 (GRCm39) M347I possibly damaging Het
Ipo5 T A 14: 121,165,949 (GRCm39) D331E probably damaging Het
Mep1a C T 17: 43,793,178 (GRCm39) C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 (GRCm38) S196P probably damaging Het
Nudt21 A T 8: 94,746,225 (GRCm39) F158I unknown Het
Padi3 T C 4: 140,518,794 (GRCm39) T443A probably benign Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Phkb A G 8: 86,738,266 (GRCm39) I520V probably benign Het
Plxna1 A G 6: 89,334,411 (GRCm39) S73P probably benign Het
Rfk T C 19: 17,372,708 (GRCm39) S77P probably damaging Het
Sdk1 A G 5: 141,941,987 (GRCm39) N545S probably benign Het
Setd2 A G 9: 110,380,232 (GRCm39) N1349S probably damaging Het
Slc22a27 T A 19: 7,887,103 (GRCm39) Q262L probably damaging Het
Slc34a3 T C 2: 25,120,607 (GRCm39) D440G probably benign Het
Slc4a4 T C 5: 89,186,402 (GRCm39) L161P probably damaging Het
Stxbp5 A C 10: 9,693,048 (GRCm39) probably null Het
Tekt1 C T 11: 72,245,660 (GRCm39) R165H probably damaging Het
Trpm1 A T 7: 63,848,998 (GRCm39) probably benign Het
Ubqln3 A C 7: 103,790,550 (GRCm39) H513Q probably damaging Het
Ubr4 A G 4: 139,129,871 (GRCm39) N664D possibly damaging Het
Usp37 G A 1: 74,509,738 (GRCm39) T477I possibly damaging Het
Zbtb11 T G 16: 55,818,556 (GRCm39) L660* probably null Het
Other mutations in Tmpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Tmpo APN 10 91,000,068 (GRCm39) splice site probably benign
IGL00791:Tmpo APN 10 90,998,420 (GRCm39) missense possibly damaging 0.94
IGL00919:Tmpo APN 10 90,998,662 (GRCm39) missense probably damaging 0.99
IGL01382:Tmpo APN 10 91,001,912 (GRCm39) missense probably damaging 1.00
IGL01806:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL01813:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL01838:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL01952:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
IGL02110:Tmpo APN 10 90,998,727 (GRCm39) missense probably damaging 1.00
IGL02122:Tmpo APN 10 90,999,998 (GRCm39) missense possibly damaging 0.77
IGL02191:Tmpo APN 10 90,997,741 (GRCm39) missense probably benign 0.00
IGL02338:Tmpo APN 10 90,999,104 (GRCm39) missense probably benign 0.01
PIT4366001:Tmpo UTSW 10 90,999,172 (GRCm39) missense probably damaging 1.00
R0133:Tmpo UTSW 10 90,999,900 (GRCm39) splice site probably benign
R0450:Tmpo UTSW 10 90,998,958 (GRCm39) missense probably benign 0.45
R0469:Tmpo UTSW 10 90,998,958 (GRCm39) missense probably benign 0.45
R0836:Tmpo UTSW 10 90,997,815 (GRCm39) nonsense probably null
R2405:Tmpo UTSW 10 90,999,216 (GRCm39) missense probably damaging 1.00
R2919:Tmpo UTSW 10 90,988,548 (GRCm39) missense probably benign 0.23
R4059:Tmpo UTSW 10 90,998,123 (GRCm39) missense probably benign 0.00
R4296:Tmpo UTSW 10 90,998,818 (GRCm39) missense possibly damaging 0.49
R4741:Tmpo UTSW 10 90,998,506 (GRCm39) missense probably benign 0.18
R4881:Tmpo UTSW 10 90,998,503 (GRCm39) missense possibly damaging 0.93
R4915:Tmpo UTSW 10 90,985,411 (GRCm39) missense probably damaging 1.00
R4917:Tmpo UTSW 10 90,985,411 (GRCm39) missense probably damaging 1.00
R4960:Tmpo UTSW 10 90,989,171 (GRCm39) missense probably damaging 1.00
R5002:Tmpo UTSW 10 90,999,976 (GRCm39) missense possibly damaging 0.76
R5301:Tmpo UTSW 10 90,985,650 (GRCm39) intron probably benign
R6167:Tmpo UTSW 10 90,998,800 (GRCm39) missense probably benign
R6190:Tmpo UTSW 10 91,000,069 (GRCm39) splice site probably null
R6979:Tmpo UTSW 10 90,988,359 (GRCm39) splice site probably null
R7880:Tmpo UTSW 10 91,001,892 (GRCm39) nonsense probably null
R8343:Tmpo UTSW 10 90,997,974 (GRCm39) missense probably benign 0.00
R8492:Tmpo UTSW 10 90,997,720 (GRCm39) missense probably benign 0.04
R8870:Tmpo UTSW 10 90,987,581 (GRCm39) missense probably damaging 1.00
R9088:Tmpo UTSW 10 90,989,138 (GRCm39) critical splice donor site probably null
R9328:Tmpo UTSW 10 90,998,825 (GRCm39) missense probably damaging 1.00
R9598:Tmpo UTSW 10 90,994,608 (GRCm39) critical splice donor site probably null
Z1177:Tmpo UTSW 10 90,998,722 (GRCm39) missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GAAGCTGGACTAATCTTACAATCC -3'
(R):5'- CGAGGCAGCACGGATATTATC -3'

Sequencing Primer
(F):5'- TGGACTAATCTTACAATCCTTCAACC -3'
(R):5'- GGCAGCACGGATATTATCAGTACC -3'
Posted On 2019-06-07