Incidental Mutation 'PIT4544001:Ifit1bl1'
ID556433
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Nameinterferon induced protein with tetratricpeptide repeats 1B like 1
SynonymsGm14446
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4544001 (G1)
Quality Score189.009
Status Not validated
Chromosome19
Chromosomal Location34592888-34601968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34594015 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 347 (M347I)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112467
AA Change: M347I

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: M347I

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168254
AA Change: M347I

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: M347I

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,405,079 D248G probably damaging Het
Abcc12 A T 8: 86,505,246 M1358K possibly damaging Het
Adgrl2 C T 3: 148,890,521 E60K probably damaging Het
Aff3 C T 1: 38,210,362 A555T probably benign Het
Aspn A T 13: 49,553,982 K106* probably null Het
Atp8b3 A T 10: 80,530,586 L281Q probably benign Het
Ccdc54 A T 16: 50,589,980 C308S possibly damaging Het
Cpa1 T C 6: 30,641,858 V227A probably benign Het
Dld G A 12: 31,335,557 Q262* probably null Het
Eif4e3 A T 6: 99,632,353 W161R probably damaging Het
Epha5 T A 5: 84,331,612 T178S possibly damaging Het
Erbb2 A T 11: 98,421,039 T134S probably benign Het
Golga3 A T 5: 110,188,690 E358D possibly damaging Het
Gon7 A T 12: 102,754,150 D74E probably benign Het
Hmcn2 A G 2: 31,428,250 E3869G probably damaging Het
Ipo5 T A 14: 120,928,537 D331E probably damaging Het
Mep1a C T 17: 43,482,287 C355Y probably damaging Het
Nkain1 A G 4: 130,532,098 S196P probably damaging Het
Nudt21 A T 8: 94,019,597 F158I unknown Het
Padi3 T C 4: 140,791,483 T443A probably benign Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Phkb A G 8: 86,011,637 I520V probably benign Het
Plxna1 A G 6: 89,357,429 S73P probably benign Het
Rfk T C 19: 17,395,344 S77P probably damaging Het
Sdk1 A G 5: 141,956,232 N545S probably benign Het
Setd2 A G 9: 110,551,164 N1349S probably damaging Het
Slc22a27 T A 19: 7,909,738 Q262L probably damaging Het
Slc34a3 T C 2: 25,230,595 D440G probably benign Het
Slc4a4 T C 5: 89,038,543 L161P probably damaging Het
Stxbp5 A C 10: 9,817,304 probably null Het
Tekt1 C T 11: 72,354,834 R165H probably damaging Het
Tmpo T C 10: 91,162,114 N604D probably benign Het
Trpm1 A T 7: 64,199,250 probably benign Het
Ubqln3 A C 7: 104,141,343 H513Q probably damaging Het
Ubr4 A G 4: 139,402,560 N664D possibly damaging Het
Usp37 G A 1: 74,470,579 T477I possibly damaging Het
Zbtb11 T G 16: 55,998,193 L660* probably null Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0420:Ifit1bl1 UTSW 19 34594514 missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34594641 missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34594044 missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34593860 missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34594193 missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2442:Ifit1bl1 UTSW 19 34594889 missense probably benign 0.00
R2858:Ifit1bl1 UTSW 19 34594322 missense probably benign 0.01
R3422:Ifit1bl1 UTSW 19 34593950 missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34594640 missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34594788 missense probably damaging 0.99
R4616:Ifit1bl1 UTSW 19 34594610 missense probably damaging 1.00
R4731:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4849:Ifit1bl1 UTSW 19 34594676 missense probably damaging 1.00
R5026:Ifit1bl1 UTSW 19 34593893 missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34594081 nonsense probably null
R5414:Ifit1bl1 UTSW 19 34593924 missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34593797 nonsense probably null
R5586:Ifit1bl1 UTSW 19 34594277 missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34594170 nonsense probably null
R6382:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R6515:Ifit1bl1 UTSW 19 34594499 missense probably damaging 1.00
R7073:Ifit1bl1 UTSW 19 34599267 critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34593902 missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34594164 missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34594005 missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34593936 missense probably benign 0.01
R7944:Ifit1bl1 UTSW 19 34593824 missense probably benign 0.00
R8251:Ifit1bl1 UTSW 19 34594832 missense possibly damaging 0.85
R8427:Ifit1bl1 UTSW 19 34599266 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGTTTCTCCAAAGCCTTG -3'
(R):5'- GCCTTTGCCATAAGAAACGAC -3'

Sequencing Primer
(F):5'- TTCTCCAAAGCCTTGAGAGG -3'
(R):5'- CCTTTGCCATAAGAAACGACTGATTC -3'
Posted On2019-06-07