Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4531001:Aqr'

556442

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4531001 (G1)

Quality Score

216.009

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 114130734 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 682 (V682L)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043160
AA Change: V682L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: V682L

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102543
AA Change: V682L

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: V682L

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Coding Region Coverage

1x: 93.0%
3x: 90.6%
10x: 84.3%
20x: 70.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	T	G	9: 59,310,317	D204E	probably damaging	Het
Bmper	A	T	9: 23,224,817	N65Y	possibly damaging	Het
Calb1	T	C	4: 15,900,925	L171P	probably damaging	Het
Card11	T	C	5: 140,906,660	M217V	probably damaging	Het
Col11a2	A	G	17: 34,046,438		probably null	Het
Dpm1	T	C	2: 168,210,552	T255A	probably benign	Het
Efhb	A	G	17: 53,445,775	Y440H	probably damaging	Het
Elp2	T	C	18: 24,604,113	V40A	probably damaging	Het
Fam103a1	C	T	7: 81,767,579	P9L	possibly damaging	Het
Far2	A	T	6: 148,175,131	N491Y	possibly damaging	Het
Frem1	T	A	4: 82,950,280	H1488L	probably benign	Het
Frrs1l	C	A	4: 56,990,144	R43L	unknown	Het
Galnt3	G	A	2: 66,107,088	R93C	probably benign	Het
Gm8225	A	G	17: 26,543,389	T185A	possibly damaging	Het
H2-Q1	T	C	17: 35,320,916	F54L	probably benign	Het
H2-Q1	A	T	17: 35,321,079	Q108L	probably damaging	Het
Hoxc12	T	G	15: 102,938,420	L249W	probably damaging	Het
Lrrc75b	A	T	10: 75,557,265	H83Q	probably damaging	Het
Muc4	A	T	16: 32,756,017	T1964S	unknown	Het
Nob1	T	C	8: 107,418,417	D142G	probably benign	Het
Olfr1155	A	G	2: 87,943,227	Y134H	probably damaging	Het
Olfr1180	A	T	2: 88,411,760	H299Q	probably benign	Het
Olfr1184	A	T	2: 88,487,257	Y175F	possibly damaging	Het
Olfr1389	T	C	11: 49,430,926	V150A	probably benign	Het
Olfr1449	G	A	19: 12,935,277	D180N	probably damaging	Het
Patj	A	T	4: 98,441,090	N527I	probably damaging	Het
Pik3c2g	A	G	6: 139,859,370	I543V		Het
Ppp1r2	A	T	16: 31,258,461	N150K	probably damaging	Het
Prl7d1	A	T	13: 27,710,178	L135Q	probably damaging	Het
Ralgds	G	T	2: 28,545,214	E461*	probably null	Het
Rasa3	T	A	8: 13,605,887	H116L	probably benign	Het
Sec24d	C	T	3: 123,343,178	P520L	probably damaging	Het
Sfmbt1	T	G	14: 30,796,326	S376A	probably benign	Het
Sspo	A	G	6: 48,481,239	T3290A	probably benign	Het
Stk25	G	A	1: 93,624,624	P345S	probably benign	Het
Sycp2l	A	G	13: 41,146,672	E454G	probably null	Het
Tecpr1	T	C	5: 144,214,067	K308E	probably damaging	Het
Thtpa	C	T	14: 55,095,505	P16S	probably damaging	Het
Trim65	T	A	11: 116,127,709	I247F	possibly damaging	Het
Trpc6	T	G	9: 8,610,148	Y206D	probably benign	Het
Ttn	G	A	2: 76,872,963	T9357I	unknown	Het
Ugt2b1	C	A	5: 86,926,483	A6S	probably benign	Het
Vmn1r175	A	G	7: 23,809,178	V8A	possibly damaging	Het
Vps13b	T	A	15: 35,878,825	I2990N	probably damaging	Het
Xirp2	G	A	2: 67,515,482	R2689Q	possibly damaging	Het
Zfp831	T	A	2: 174,646,723	Y1064N	possibly damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CCATTCTGATTTTACCTGAAAGGG -3'
(R):5'- AGTCTTGCCAAGCACCTGTC -3'

Sequencing Primer
(F):5'- TGGAGTGCTGGGTCACTCAC -3'
(R):5'- GTCAGCAGAAAGTAGCTTCTTGCC -3'

Posted On

2019-06-07