Incidental Mutation 'PIT4531001:Patj'
ID556449
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4531001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98441090 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 527 (N527I)
Ref Sequence ENSEMBL: ENSMUSP00000049176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107030] [ENSMUST00000107033] [ENSMUST00000107034]
Predicted Effect probably damaging
Transcript: ENSMUST00000041284
AA Change: N527I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: N527I

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107030
AA Change: N527I

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102645
Gene: ENSMUSG00000061859
AA Change: N527I

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107033
AA Change: N527I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859
AA Change: N527I

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
low complexity region 648 659 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
PDZ 751 834 8.65e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107034
AA Change: N523I

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: N523I

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116021
Gene: ENSMUSG00000061859
AA Change: N5I

DomainStartEndE-ValueType
PDZ 49 120 1.28e-12 SMART
PDZ 175 254 9.5e-16 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk T G 9: 59,310,317 D204E probably damaging Het
Aqr C A 2: 114,130,734 V682L possibly damaging Het
Bmper A T 9: 23,224,817 N65Y possibly damaging Het
Calb1 T C 4: 15,900,925 L171P probably damaging Het
Card11 T C 5: 140,906,660 M217V probably damaging Het
Col11a2 A G 17: 34,046,438 probably null Het
Dpm1 T C 2: 168,210,552 T255A probably benign Het
Efhb A G 17: 53,445,775 Y440H probably damaging Het
Elp2 T C 18: 24,604,113 V40A probably damaging Het
Fam103a1 C T 7: 81,767,579 P9L possibly damaging Het
Far2 A T 6: 148,175,131 N491Y possibly damaging Het
Frem1 T A 4: 82,950,280 H1488L probably benign Het
Frrs1l C A 4: 56,990,144 R43L unknown Het
Galnt3 G A 2: 66,107,088 R93C probably benign Het
Gm8225 A G 17: 26,543,389 T185A possibly damaging Het
H2-Q1 T C 17: 35,320,916 F54L probably benign Het
H2-Q1 A T 17: 35,321,079 Q108L probably damaging Het
Hoxc12 T G 15: 102,938,420 L249W probably damaging Het
Lrrc75b A T 10: 75,557,265 H83Q probably damaging Het
Muc4 A T 16: 32,756,017 T1964S unknown Het
Nob1 T C 8: 107,418,417 D142G probably benign Het
Olfr1155 A G 2: 87,943,227 Y134H probably damaging Het
Olfr1180 A T 2: 88,411,760 H299Q probably benign Het
Olfr1184 A T 2: 88,487,257 Y175F possibly damaging Het
Olfr1389 T C 11: 49,430,926 V150A probably benign Het
Olfr1449 G A 19: 12,935,277 D180N probably damaging Het
Pik3c2g A G 6: 139,859,370 I543V Het
Ppp1r2 A T 16: 31,258,461 N150K probably damaging Het
Prl7d1 A T 13: 27,710,178 L135Q probably damaging Het
Ralgds G T 2: 28,545,214 E461* probably null Het
Rasa3 T A 8: 13,605,887 H116L probably benign Het
Sec24d C T 3: 123,343,178 P520L probably damaging Het
Sfmbt1 T G 14: 30,796,326 S376A probably benign Het
Sspo A G 6: 48,481,239 T3290A probably benign Het
Stk25 G A 1: 93,624,624 P345S probably benign Het
Sycp2l A G 13: 41,146,672 E454G probably null Het
Tecpr1 T C 5: 144,214,067 K308E probably damaging Het
Thtpa C T 14: 55,095,505 P16S probably damaging Het
Trim65 T A 11: 116,127,709 I247F possibly damaging Het
Trpc6 T G 9: 8,610,148 Y206D probably benign Het
Ttn G A 2: 76,872,963 T9357I unknown Het
Ugt2b1 C A 5: 86,926,483 A6S probably benign Het
Vmn1r175 A G 7: 23,809,178 V8A possibly damaging Het
Vps13b T A 15: 35,878,825 I2990N probably damaging Het
Xirp2 G A 2: 67,515,482 R2689Q possibly damaging Het
Zfp831 T A 2: 174,646,723 Y1064N possibly damaging Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7883:Patj UTSW 4 98611135 missense probably benign 0.00
R7948:Patj UTSW 4 98424310 missense probably damaging 0.99
R8050:Patj UTSW 4 98538964 missense probably benign 0.00
R8483:Patj UTSW 4 98424302 missense probably damaging 1.00
R8546:Patj UTSW 4 98437397 missense probably benign 0.00
R8746:Patj UTSW 4 98505830 intron probably benign
R8844:Patj UTSW 4 98591969 missense probably damaging 1.00
R8905:Patj UTSW 4 98497175 missense probably damaging 1.00
R8912:Patj UTSW 4 98497328 missense
R8959:Patj UTSW 4 98591975 missense probably damaging 0.99
Z1176:Patj UTSW 4 98611130 missense probably benign 0.11
Z1176:Patj UTSW 4 98676318 nonsense probably null
Z1177:Patj UTSW 4 98497174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGTTTAACCACAGTGGCTC -3'
(R):5'- GATTGCTCTAATCGGAAAGAAAGAC -3'

Sequencing Primer
(F):5'- AGCCACTGGGATTTACATTCCTAGG -3'
(R):5'- CTCTAATCGGAAAGAAAGACAGGAAG -3'
Posted On2019-06-07