Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4531001:Tecpr1'

556452

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4531001 (G1)

Quality Score

107.008

Status

Not validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144214067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 308 (K308E)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000085701
AA Change: K308E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: K308E

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 93.0%
3x: 90.6%
10x: 84.3%
20x: 70.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	T	G	9: 59,310,317	D204E	probably damaging	Het
Aqr	C	A	2: 114,130,734	V682L	possibly damaging	Het
Bmper	A	T	9: 23,224,817	N65Y	possibly damaging	Het
Calb1	T	C	4: 15,900,925	L171P	probably damaging	Het
Card11	T	C	5: 140,906,660	M217V	probably damaging	Het
Col11a2	A	G	17: 34,046,438		probably null	Het
Dpm1	T	C	2: 168,210,552	T255A	probably benign	Het
Efhb	A	G	17: 53,445,775	Y440H	probably damaging	Het
Elp2	T	C	18: 24,604,113	V40A	probably damaging	Het
Fam103a1	C	T	7: 81,767,579	P9L	possibly damaging	Het
Far2	A	T	6: 148,175,131	N491Y	possibly damaging	Het
Frem1	T	A	4: 82,950,280	H1488L	probably benign	Het
Frrs1l	C	A	4: 56,990,144	R43L	unknown	Het
Galnt3	G	A	2: 66,107,088	R93C	probably benign	Het
Gm8225	A	G	17: 26,543,389	T185A	possibly damaging	Het
H2-Q1	T	C	17: 35,320,916	F54L	probably benign	Het
H2-Q1	A	T	17: 35,321,079	Q108L	probably damaging	Het
Hoxc12	T	G	15: 102,938,420	L249W	probably damaging	Het
Lrrc75b	A	T	10: 75,557,265	H83Q	probably damaging	Het
Muc4	A	T	16: 32,756,017	T1964S	unknown	Het
Nob1	T	C	8: 107,418,417	D142G	probably benign	Het
Olfr1155	A	G	2: 87,943,227	Y134H	probably damaging	Het
Olfr1180	A	T	2: 88,411,760	H299Q	probably benign	Het
Olfr1184	A	T	2: 88,487,257	Y175F	possibly damaging	Het
Olfr1389	T	C	11: 49,430,926	V150A	probably benign	Het
Olfr1449	G	A	19: 12,935,277	D180N	probably damaging	Het
Patj	A	T	4: 98,441,090	N527I	probably damaging	Het
Pik3c2g	A	G	6: 139,859,370	I543V		Het
Ppp1r2	A	T	16: 31,258,461	N150K	probably damaging	Het
Prl7d1	A	T	13: 27,710,178	L135Q	probably damaging	Het
Ralgds	G	T	2: 28,545,214	E461*	probably null	Het
Rasa3	T	A	8: 13,605,887	H116L	probably benign	Het
Sec24d	C	T	3: 123,343,178	P520L	probably damaging	Het
Sfmbt1	T	G	14: 30,796,326	S376A	probably benign	Het
Sspo	A	G	6: 48,481,239	T3290A	probably benign	Het
Stk25	G	A	1: 93,624,624	P345S	probably benign	Het
Sycp2l	A	G	13: 41,146,672	E454G	probably null	Het
Thtpa	C	T	14: 55,095,505	P16S	probably damaging	Het
Trim65	T	A	11: 116,127,709	I247F	possibly damaging	Het
Trpc6	T	G	9: 8,610,148	Y206D	probably benign	Het
Ttn	G	A	2: 76,872,963	T9357I	unknown	Het
Ugt2b1	C	A	5: 86,926,483	A6S	probably benign	Het
Vmn1r175	A	G	7: 23,809,178	V8A	possibly damaging	Het
Vps13b	T	A	15: 35,878,825	I2990N	probably damaging	Het
Xirp2	G	A	2: 67,515,482	R2689Q	possibly damaging	Het
Zfp831	T	A	2: 174,646,723	Y1064N	possibly damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCCTGGAGATAGGGGATGATTCAG -3'
(R):5'- AAGGTAGCCAGCCCCATGATAG -3'

Sequencing Primer
(F):5'- AAAATTGGGTCCCCGACACTTTG -3'
(R):5'- CAGCCCCATGATAGGAAGCG -3'

Posted On

2019-06-07