Incidental Mutation 'R0605:Tars3'
ID 55646
Institutional Source Beutler Lab
Gene Symbol Tars3
Ensembl Gene ENSMUSG00000030515
Gene Name threonyl-tRNA synthetase 3
Synonyms A530046H20Rik, Tarsl2
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R0605 (G1)
Quality Score 208
Status Validated
Chromosome 7
Chromosomal Location 65294646-65341839 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65327819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 509 (R509S)
Ref Sequence ENSEMBL: ENSMUSP00000032728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032728]
AlphaFold Q8BLY2
Predicted Effect probably damaging
Transcript: ENSMUST00000032728
AA Change: R509S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032728
Gene: ENSMUSG00000030515
AA Change: R509S

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
coiled coil region 44 68 N/A INTRINSIC
Pfam:TGS 151 210 8.8e-14 PFAM
tRNA_SAD 316 365 1.26e-16 SMART
Pfam:tRNA-synt_2b 464 675 2.2e-35 PFAM
Pfam:HGTP_anticodon 687 778 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127354
Meta Mutation Damage Score 0.9340 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Tars3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tars3 APN 7 65,302,007 (GRCm39) critical splice acceptor site probably null
IGL00470:Tars3 APN 7 65,338,656 (GRCm39) missense probably benign 0.03
IGL00594:Tars3 APN 7 65,325,880 (GRCm39) critical splice donor site probably null
IGL01352:Tars3 APN 7 65,308,658 (GRCm39) missense possibly damaging 0.80
IGL01519:Tars3 APN 7 65,313,634 (GRCm39) missense probably damaging 1.00
IGL01726:Tars3 APN 7 65,332,566 (GRCm39) missense possibly damaging 0.46
IGL02370:Tars3 APN 7 65,310,913 (GRCm39) missense probably benign 0.17
IGL02729:Tars3 APN 7 65,332,567 (GRCm39) missense probably damaging 0.97
IGL03234:Tars3 APN 7 65,302,026 (GRCm39) missense probably benign 0.06
gary UTSW 7 65,338,700 (GRCm39) critical splice donor site probably null
R8254_tarsl2_650 UTSW 7 65,325,809 (GRCm39) missense probably benign
smart_money UTSW 7 65,327,890 (GRCm39) missense probably damaging 1.00
R0127:Tars3 UTSW 7 65,314,717 (GRCm39) missense probably benign 0.19
R0153:Tars3 UTSW 7 65,333,829 (GRCm39) missense probably damaging 1.00
R1070:Tars3 UTSW 7 65,305,444 (GRCm39) missense probably damaging 1.00
R1450:Tars3 UTSW 7 65,297,244 (GRCm39) missense probably benign 0.01
R1467:Tars3 UTSW 7 65,305,444 (GRCm39) missense probably damaging 1.00
R1467:Tars3 UTSW 7 65,305,444 (GRCm39) missense probably damaging 1.00
R2142:Tars3 UTSW 7 65,308,645 (GRCm39) missense probably benign
R2143:Tars3 UTSW 7 65,305,539 (GRCm39) missense possibly damaging 0.57
R2144:Tars3 UTSW 7 65,305,539 (GRCm39) missense possibly damaging 0.57
R2145:Tars3 UTSW 7 65,305,539 (GRCm39) missense possibly damaging 0.57
R2208:Tars3 UTSW 7 65,332,596 (GRCm39) missense probably damaging 1.00
R3713:Tars3 UTSW 7 65,338,700 (GRCm39) critical splice donor site probably null
R3715:Tars3 UTSW 7 65,338,700 (GRCm39) critical splice donor site probably null
R3914:Tars3 UTSW 7 65,333,556 (GRCm39) missense probably benign 0.05
R3929:Tars3 UTSW 7 65,333,791 (GRCm39) splice site probably null
R4008:Tars3 UTSW 7 65,327,876 (GRCm39) missense probably damaging 1.00
R4064:Tars3 UTSW 7 65,302,018 (GRCm39) missense possibly damaging 0.90
R4367:Tars3 UTSW 7 65,332,567 (GRCm39) missense probably damaging 0.97
R4652:Tars3 UTSW 7 65,339,717 (GRCm39) missense probably damaging 1.00
R4825:Tars3 UTSW 7 65,297,302 (GRCm39) missense probably benign 0.38
R4901:Tars3 UTSW 7 65,341,042 (GRCm39) missense probably benign 0.05
R4999:Tars3 UTSW 7 65,308,683 (GRCm39) missense probably damaging 0.99
R5423:Tars3 UTSW 7 65,333,567 (GRCm39) missense probably benign 0.00
R5756:Tars3 UTSW 7 65,325,724 (GRCm39) missense probably benign 0.22
R5772:Tars3 UTSW 7 65,333,873 (GRCm39) missense probably damaging 1.00
R6160:Tars3 UTSW 7 65,332,527 (GRCm39) missense probably benign 0.32
R6230:Tars3 UTSW 7 65,336,184 (GRCm39) splice site probably null
R6424:Tars3 UTSW 7 65,305,487 (GRCm39) missense probably damaging 1.00
R6615:Tars3 UTSW 7 65,327,890 (GRCm39) missense probably damaging 1.00
R6792:Tars3 UTSW 7 65,312,051 (GRCm39) missense probably damaging 1.00
R7350:Tars3 UTSW 7 65,308,672 (GRCm39) missense probably damaging 1.00
R7549:Tars3 UTSW 7 65,297,341 (GRCm39) missense probably damaging 0.96
R7592:Tars3 UTSW 7 65,308,619 (GRCm39) missense probably benign 0.01
R7634:Tars3 UTSW 7 65,325,760 (GRCm39) missense probably damaging 0.99
R7710:Tars3 UTSW 7 65,314,717 (GRCm39) missense probably benign 0.19
R7808:Tars3 UTSW 7 65,302,009 (GRCm39) missense probably benign 0.01
R7875:Tars3 UTSW 7 65,327,899 (GRCm39) missense probably benign 0.05
R8254:Tars3 UTSW 7 65,325,809 (GRCm39) missense probably benign
R8793:Tars3 UTSW 7 65,294,673 (GRCm39) start gained probably benign
R9162:Tars3 UTSW 7 65,332,518 (GRCm39) missense probably benign 0.01
R9200:Tars3 UTSW 7 65,302,013 (GRCm39) missense probably benign
R9461:Tars3 UTSW 7 65,339,719 (GRCm39) missense possibly damaging 0.68
R9533:Tars3 UTSW 7 65,333,808 (GRCm39) critical splice acceptor site probably null
Z1177:Tars3 UTSW 7 65,302,012 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGCAAAAGGTTTGATCCCTGCTG -3'
(R):5'- ACCCCACATGCTGTTGTTCCATAAG -3'

Sequencing Primer
(F):5'- tcataaaaaaaaaaatCCTGTTGCCC -3'
(R):5'- AGCAAAGGTTTCTCTCAGCG -3'
Posted On 2013-07-11