Incidental Mutation 'PIT4531001:Ppp1r2'
ID556472
Institutional Source Beutler Lab
Gene Symbol Ppp1r2
Ensembl Gene ENSMUSG00000047714
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #PIT4531001 (G1)
Quality Score213.009
Status Not validated
Chromosome16
Chromosomal Location31251537-31275277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31258461 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 150 (N150K)
Ref Sequence ENSEMBL: ENSMUSP00000060118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060188] [ENSMUST00000115233]
PDB Structure
rat PP1cgamma complexed with mouse inhibitor-2 [X-RAY DIFFRACTION]
Rat pp1c gamma complexed with mouse inhibitor-2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000060188
AA Change: N150K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060118
Gene: ENSMUSG00000047714
AA Change: N150K

DomainStartEndE-ValueType
Pfam:IPP-2 46 174 6.6e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115233
AA Change: N150K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110888
Gene: ENSMUSG00000047714
AA Change: N150K

DomainStartEndE-ValueType
Pfam:IPP-2 43 175 1.4e-61 PFAM
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase-1 (PP1) is one of the main eukaryotic serine/threonine phosphatases. The protein encoded by this gene binds to the catalytic subunit of PP1, strongly inhibiting its activity. Ten related pseudogenes have been found throughout the human genome. Several splice variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice die during organogenesis. Heterozygous null mice display responses in behavioral assays suggesting enhanced memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk T G 9: 59,310,317 D204E probably damaging Het
Aqr C A 2: 114,130,734 V682L possibly damaging Het
Bmper A T 9: 23,224,817 N65Y possibly damaging Het
Calb1 T C 4: 15,900,925 L171P probably damaging Het
Card11 T C 5: 140,906,660 M217V probably damaging Het
Col11a2 A G 17: 34,046,438 probably null Het
Dpm1 T C 2: 168,210,552 T255A probably benign Het
Efhb A G 17: 53,445,775 Y440H probably damaging Het
Elp2 T C 18: 24,604,113 V40A probably damaging Het
Fam103a1 C T 7: 81,767,579 P9L possibly damaging Het
Far2 A T 6: 148,175,131 N491Y possibly damaging Het
Frem1 T A 4: 82,950,280 H1488L probably benign Het
Frrs1l C A 4: 56,990,144 R43L unknown Het
Galnt3 G A 2: 66,107,088 R93C probably benign Het
Gm8225 A G 17: 26,543,389 T185A possibly damaging Het
H2-Q1 T C 17: 35,320,916 F54L probably benign Het
H2-Q1 A T 17: 35,321,079 Q108L probably damaging Het
Hoxc12 T G 15: 102,938,420 L249W probably damaging Het
Lrrc75b A T 10: 75,557,265 H83Q probably damaging Het
Muc4 A T 16: 32,756,017 T1964S unknown Het
Nob1 T C 8: 107,418,417 D142G probably benign Het
Olfr1155 A G 2: 87,943,227 Y134H probably damaging Het
Olfr1180 A T 2: 88,411,760 H299Q probably benign Het
Olfr1184 A T 2: 88,487,257 Y175F possibly damaging Het
Olfr1389 T C 11: 49,430,926 V150A probably benign Het
Olfr1449 G A 19: 12,935,277 D180N probably damaging Het
Patj A T 4: 98,441,090 N527I probably damaging Het
Pik3c2g A G 6: 139,859,370 I543V Het
Prl7d1 A T 13: 27,710,178 L135Q probably damaging Het
Ralgds G T 2: 28,545,214 E461* probably null Het
Rasa3 T A 8: 13,605,887 H116L probably benign Het
Sec24d C T 3: 123,343,178 P520L probably damaging Het
Sfmbt1 T G 14: 30,796,326 S376A probably benign Het
Sspo A G 6: 48,481,239 T3290A probably benign Het
Stk25 G A 1: 93,624,624 P345S probably benign Het
Sycp2l A G 13: 41,146,672 E454G probably null Het
Tecpr1 T C 5: 144,214,067 K308E probably damaging Het
Thtpa C T 14: 55,095,505 P16S probably damaging Het
Trim65 T A 11: 116,127,709 I247F possibly damaging Het
Trpc6 T G 9: 8,610,148 Y206D probably benign Het
Ttn G A 2: 76,872,963 T9357I unknown Het
Ugt2b1 C A 5: 86,926,483 A6S probably benign Het
Vmn1r175 A G 7: 23,809,178 V8A possibly damaging Het
Vps13b T A 15: 35,878,825 I2990N probably damaging Het
Xirp2 G A 2: 67,515,482 R2689Q possibly damaging Het
Zfp831 T A 2: 174,646,723 Y1064N possibly damaging Het
Other mutations in Ppp1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2321:Ppp1r2 UTSW 16 31265303 critical splice donor site probably null
R4573:Ppp1r2 UTSW 16 31260637 missense possibly damaging 0.85
R6230:Ppp1r2 UTSW 16 31260600 missense possibly damaging 0.82
R7113:Ppp1r2 UTSW 16 31254718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAAGTCCACCTGCAGAGCC -3'
(R):5'- CCTCCCATTTAACTATTGCTGGAAAG -3'

Sequencing Primer
(F):5'- AGGCACTGTCTTAGGCACAG -3'
(R):5'- GGTCTTACTACAAACTACCTGACTG -3'
Posted On2019-06-07