Incidental Mutation 'PIT4581001:Slco6d1'
ID556482
Institutional Source Beutler Lab
Gene Symbol Slco6d1
Ensembl Gene ENSMUSG00000026336
Gene Namesolute carrier organic anion transporter family, member 6d1
Synonyms4921511I05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location98421124-98516991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98423325 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 177 (I177L)
Ref Sequence ENSEMBL: ENSMUSP00000027575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027575] [ENSMUST00000160796] [ENSMUST00000162468]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027575
AA Change: I177L

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027575
Gene: ENSMUSG00000026336
AA Change: I177L

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 1.8e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160796
AA Change: I177L

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123850
Gene: ENSMUSG00000026336
AA Change: I177L

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 2.4e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162468
AA Change: I134L

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125258
Gene: ENSMUSG00000026336
AA Change: I134L

DomainStartEndE-ValueType
Pfam:OATP 64 313 2.1e-27 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Slco6d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slco6d1 APN 1 98432230 splice site probably null
IGL00678:Slco6d1 APN 1 98496344 missense probably benign 0.01
IGL00790:Slco6d1 APN 1 98421200 utr 5 prime probably benign
IGL01694:Slco6d1 APN 1 98499845 missense probably damaging 1.00
IGL02003:Slco6d1 APN 1 98480768 missense probably damaging 1.00
IGL02059:Slco6d1 APN 1 98446806 missense possibly damaging 0.95
IGL02085:Slco6d1 APN 1 98443743 missense probably damaging 1.00
IGL02683:Slco6d1 APN 1 98480672 missense probably benign 0.05
IGL02736:Slco6d1 APN 1 98428311 missense possibly damaging 0.55
IGL03279:Slco6d1 APN 1 98466680 missense probably damaging 1.00
R0326:Slco6d1 UTSW 1 98490634 missense probably benign 0.02
R0359:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0554:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0589:Slco6d1 UTSW 1 98499747 splice site probably benign
R0733:Slco6d1 UTSW 1 98428269 nonsense probably null
R0883:Slco6d1 UTSW 1 98421399 missense probably benign 0.00
R1316:Slco6d1 UTSW 1 98466793 missense probably benign 0.02
R1370:Slco6d1 UTSW 1 98423094 missense probably benign 0.01
R1401:Slco6d1 UTSW 1 98490616 missense probably damaging 1.00
R1691:Slco6d1 UTSW 1 98507567 missense probably benign 0.34
R1740:Slco6d1 UTSW 1 98428372 missense probably damaging 1.00
R1767:Slco6d1 UTSW 1 98490549 missense possibly damaging 0.90
R1827:Slco6d1 UTSW 1 98421216 missense probably damaging 0.96
R2138:Slco6d1 UTSW 1 98443660 missense probably benign 0.19
R2849:Slco6d1 UTSW 1 98466716 missense probably benign 0.02
R3753:Slco6d1 UTSW 1 98499777 missense probably damaging 0.99
R4066:Slco6d1 UTSW 1 98463846 critical splice acceptor site probably benign
R4429:Slco6d1 UTSW 1 98496366 missense possibly damaging 0.66
R4480:Slco6d1 UTSW 1 98507574 nonsense probably null
R4656:Slco6d1 UTSW 1 98423203 missense probably benign 0.06
R4810:Slco6d1 UTSW 1 98423254 missense possibly damaging 0.83
R4814:Slco6d1 UTSW 1 98423174 missense probably benign 0.15
R5389:Slco6d1 UTSW 1 98443644 missense probably benign 0.00
R5504:Slco6d1 UTSW 1 98421339 missense probably damaging 0.99
R5619:Slco6d1 UTSW 1 98496222 missense probably damaging 1.00
R5688:Slco6d1 UTSW 1 98480768 missense probably damaging 1.00
R5820:Slco6d1 UTSW 1 98499778 missense probably damaging 0.97
R5878:Slco6d1 UTSW 1 98463836 splice site probably benign
R6261:Slco6d1 UTSW 1 98499863 missense probably benign 0.10
R6450:Slco6d1 UTSW 1 98421467 missense probably benign 0.29
R6452:Slco6d1 UTSW 1 98421212 missense probably benign 0.44
R7338:Slco6d1 UTSW 1 98421372 missense probably benign 0.11
R7375:Slco6d1 UTSW 1 98421447 missense probably damaging 1.00
R7456:Slco6d1 UTSW 1 98421357 missense possibly damaging 0.66
R7567:Slco6d1 UTSW 1 98497527 missense probably damaging 1.00
R7729:Slco6d1 UTSW 1 98497523 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATCTCCATCACGGATAGAGGAATAC -3'
(R):5'- ATGACTTTCCAGAGTTCTCTAGAG -3'

Sequencing Primer
(F):5'- TCACGGATAGAGGAATACTTAATGG -3'
(R):5'- ACTTTCCAGAGTTCTCTAGAGATTTG -3'
Posted On2019-06-07