Incidental Mutation 'PIT4581001:Dbi'
ID556483
Institutional Source Beutler Lab
Gene Symbol Dbi
Ensembl Gene ENSMUSG00000026385
Gene Namediazepam binding inhibitor
SynonymsAcbp, diazepam-binding inhibitor, EP, endozepine
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #PIT4581001 (G1)
Quality Score127.008
Status Not validated
Chromosome1
Chromosomal Location120113280-120121078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120119912 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 85 (V85E)
Ref Sequence ENSEMBL: ENSMUSP00000114705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027634] [ENSMUST00000027637] [ENSMUST00000056038] [ENSMUST00000112644] [ENSMUST00000112648] [ENSMUST00000132118] [ENSMUST00000151708]
Predicted Effect probably benign
Transcript: ENSMUST00000027634
AA Change: V37E

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027634
Gene: ENSMUSG00000026385
AA Change: V37E

DomainStartEndE-ValueType
Pfam:ACBP 3 83 1.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027637
SMART Domains Protein: ENSMUSP00000027637
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056038
SMART Domains Protein: ENSMUSP00000053335
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112644
SMART Domains Protein: ENSMUSP00000108263
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 126 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112648
AA Change: V13E

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108267
Gene: ENSMUSG00000026385
AA Change: V13E

DomainStartEndE-ValueType
Pfam:ACBP 1 62 2.6e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132118
AA Change: V37E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138014
Gene: ENSMUSG00000026385
AA Change: V37E

DomainStartEndE-ValueType
Pfam:ACBP 2 70 7.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151708
AA Change: V85E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114705
Gene: ENSMUSG00000026385
AA Change: V85E

DomainStartEndE-ValueType
Pfam:ACBP 50 134 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal fur and skin morphology at P16 and impaired metabolic changes at weaning with reduced growth and hepatic cholesterol synthesis. Mice homozygous for a different knock-out allele complete exhibit embryonic lethality around implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Dbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Dbi APN 1 120113477 missense probably benign 0.06
R2964:Dbi UTSW 1 120120116 intron probably benign
R4483:Dbi UTSW 1 120120805 missense probably benign 0.00
R5935:Dbi UTSW 1 120120853 missense probably benign 0.41
R7357:Dbi UTSW 1 120119893 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATGGTCTTTGCAGGTGAC -3'
(R):5'- CTGTAACTGCTTGAGTGGACAG -3'

Sequencing Primer
(F):5'- TGCAGGTGACAATCTCTCAG -3'
(R):5'- CCTTAGGGAATCCTGGCAAG -3'
Posted On2019-06-07