Incidental Mutation 'PIT4581001:Zfp786'
ID556499
Institutional Source Beutler Lab
Gene Symbol Zfp786
Ensembl Gene ENSMUSG00000051499
Gene Namezinc finger protein 786
SynonymsA730012O14Rik
Accession Numbers

Genbank: NM_177882; MGI: 3026883

Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #PIT4581001 (G1)
Quality Score114.008
Status Not validated
Chromosome6
Chromosomal Location47819266-47830867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47819822 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 727 (F727L)
Ref Sequence ENSEMBL: ENSMUSP00000057495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058844]
Predicted Effect probably damaging
Transcript: ENSMUST00000058844
AA Change: F727L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057495
Gene: ENSMUSG00000051499
AA Change: F727L

DomainStartEndE-ValueType
KRAB 9 69 2.6e-22 SMART
low complexity region 156 164 N/A INTRINSIC
ZnF_C2H2 240 262 5.34e-1 SMART
ZnF_C2H2 268 295 1.41e2 SMART
ZnF_C2H2 420 440 1.21e2 SMART
ZnF_C2H2 448 470 3.52e-1 SMART
ZnF_C2H2 476 498 1.89e-1 SMART
ZnF_C2H2 504 526 1.69e-3 SMART
ZnF_C2H2 532 554 5.59e-4 SMART
ZnF_C2H2 560 582 4.79e-3 SMART
ZnF_C2H2 588 610 3.69e-4 SMART
ZnF_C2H2 616 638 3.63e-3 SMART
ZnF_C2H2 644 665 5.92e0 SMART
ZnF_C2H2 671 693 2.57e-3 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 1.45e-2 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Zfp786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp786 APN 6 47819671 makesense probably null
IGL02442:Zfp786 APN 6 47821367 missense probably benign 0.00
IGL02674:Zfp786 APN 6 47820493 missense probably benign 0.22
IGL02814:Zfp786 APN 6 47819841 missense probably damaging 1.00
IGL03072:Zfp786 APN 6 47821243 missense probably benign 0.01
IGL03294:Zfp786 APN 6 47821324 nonsense probably null
IGL03393:Zfp786 APN 6 47821524 missense possibly damaging 0.88
3-1:Zfp786 UTSW 6 47820445 missense probably damaging 1.00
R1071:Zfp786 UTSW 6 47821305 missense possibly damaging 0.91
R1426:Zfp786 UTSW 6 47825079 missense probably benign 0.17
R1976:Zfp786 UTSW 6 47819757 missense probably damaging 1.00
R2114:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2115:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2117:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2176:Zfp786 UTSW 6 47820971 missense possibly damaging 0.65
R2304:Zfp786 UTSW 6 47820699 missense probably damaging 1.00
R3110:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3112:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3623:Zfp786 UTSW 6 47821423 missense probably benign 0.00
R4654:Zfp786 UTSW 6 47820934 missense probably benign 0.01
R4741:Zfp786 UTSW 6 47820691 missense probably damaging 1.00
R4927:Zfp786 UTSW 6 47820153 missense probably benign 0.43
R4936:Zfp786 UTSW 6 47821268 nonsense probably null
R5084:Zfp786 UTSW 6 47820019 missense probably benign 0.00
R5445:Zfp786 UTSW 6 47819685 missense probably damaging 1.00
R6662:Zfp786 UTSW 6 47826986 missense probably damaging 1.00
R7290:Zfp786 UTSW 6 47819995 missense probably damaging 1.00
R7561:Zfp786 UTSW 6 47819733 missense probably benign 0.02
R8038:Zfp786 UTSW 6 47821254 missense probably benign 0.01
R8090:Zfp786 UTSW 6 47820009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAATTAAGCTTTGCTCCC -3'
(R):5'- GCCAAGCAATCTAAACTCGTGG -3'

Sequencing Primer
(F):5'- CAGAGCTGCCGTCCCAC -3'
(R):5'- GAGAGAAGCCTTTTCAGTGTCCC -3'
Posted On2019-06-07