Incidental Mutation 'PIT4581001:Tmod2'
ID556508
Institutional Source Beutler Lab
Gene Symbol Tmod2
Ensembl Gene ENSMUSG00000032186
Gene Nametropomodulin 2
SynonymsNTMOD, neural tropomodulin, N-Tmod
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location75565621-75611325 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75597301 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 12 (Y12C)
Ref Sequence ENSEMBL: ENSMUSP00000069956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064433] [ENSMUST00000098552] [ENSMUST00000164100] [ENSMUST00000213565] [ENSMUST00000215036] [ENSMUST00000215462] [ENSMUST00000215614] [ENSMUST00000217233]
Predicted Effect probably damaging
Transcript: ENSMUST00000064433
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069956
Gene: ENSMUSG00000032186
AA Change: Y12C

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098552
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096152
Gene: ENSMUSG00000032186
AA Change: Y12C

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 147 1.7e-68 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164100
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126739
Gene: ENSMUSG00000032186
AA Change: Y12C

DomainStartEndE-ValueType
Pfam:Tropomodulin 5 146 6.3e-59 PFAM
PDB:1IO0|A 163 346 1e-80 PDB
SCOP:d1yrga_ 194 291 4e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213565
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215036
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215462
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215614
AA Change: Y12C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217233
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal-specific member of the tropomodulin family of actin-regulatory proteins. The encoded protein caps the pointed end of actin filaments preventing both elongation and depolymerization. The capping activity of this protein is dependent on its association with tropomyosin. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in enhanced LTP, hyperactivity, impaired startle response, and impaired learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Tmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Tmod2 APN 9 75595001 missense probably benign 0.00
IGL02732:Tmod2 APN 9 75586172 missense possibly damaging 0.94
IGL03255:Tmod2 APN 9 75577258 splice site probably benign
R0589:Tmod2 UTSW 9 75576759 missense probably damaging 1.00
R0723:Tmod2 UTSW 9 75595055 missense possibly damaging 0.93
R1721:Tmod2 UTSW 9 75586042 splice site probably benign
R2056:Tmod2 UTSW 9 75577242 missense probably benign 0.00
R2119:Tmod2 UTSW 9 75586095 missense possibly damaging 0.46
R2248:Tmod2 UTSW 9 75592649 missense probably benign 0.03
R4522:Tmod2 UTSW 9 75592584 missense probably benign 0.10
R4755:Tmod2 UTSW 9 75597212 nonsense probably null
R7149:Tmod2 UTSW 9 75581885 missense possibly damaging 0.52
R7363:Tmod2 UTSW 9 75576741 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGTCAAAATGGCTCAGCAGC -3'
(R):5'- TAGATTCCATTGCGAGCCTG -3'

Sequencing Primer
(F):5'- TGTGGGGACTTCAGCAAC -3'
(R):5'- TAGTGTGAAGCCTCAGGA -3'
Posted On2019-06-07