Incidental Mutation 'PIT4581001:Trpc1'
ID556510
Institutional Source Beutler Lab
Gene Symbol Trpc1
Ensembl Gene ENSMUSG00000032839
Gene Nametransient receptor potential cation channel, subfamily C, member 1
SynonymsTrrp1, Mtrp1, Trp1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location95705082-95750375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95736921 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000139672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053785] [ENSMUST00000186235] [ENSMUST00000189137] [ENSMUST00000190497] [ENSMUST00000190604]
Predicted Effect probably benign
Transcript: ENSMUST00000053785
SMART Domains Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 2.6e-27 PFAM
transmembrane domain 367 386 N/A INTRINSIC
Pfam:Ion_trans 407 673 5.9e-17 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186235
SMART Domains Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
Blast:ANK 15 44 7e-12 BLAST
Pfam:TRP_2 50 105 1e-18 PFAM
transmembrane domain 201 222 N/A INTRINSIC
transmembrane domain 237 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189137
AA Change: S126P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839
AA Change: S126P

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
ANK 62 93 1.41e2 SMART
ANK 99 129 2.11e1 SMART
ANK 174 203 1.33e2 SMART
Pfam:TRP_2 209 271 1.8e-29 PFAM
transmembrane domain 367 386 N/A INTRINSIC
transmembrane domain 407 424 N/A INTRINSIC
Pfam:Ion_trans 441 661 1.2e-21 PFAM
coiled coil region 770 794 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190497
AA Change: V74A
SMART Domains Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839
AA Change: V74A

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190604
SMART Domains Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Trpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Trpc1 APN 9 95726494 missense probably damaging 1.00
IGL02094:Trpc1 APN 9 95743281 missense probably damaging 1.00
IGL02412:Trpc1 APN 9 95736861 missense probably damaging 1.00
IGL02494:Trpc1 APN 9 95708307 missense probably damaging 1.00
IGL02943:Trpc1 APN 9 95708853 splice site probably benign
IGL03025:Trpc1 APN 9 95710260 missense probably damaging 1.00
IGL03221:Trpc1 APN 9 95706900 missense probably damaging 1.00
Enlarged UTSW 9 95721471 critical splice acceptor site probably null
luxus UTSW 9 95721132 critical splice donor site probably null
Magnified UTSW 9 95726437 missense probably damaging 1.00
R0034:Trpc1 UTSW 9 95749761 missense probably damaging 0.98
R1973:Trpc1 UTSW 9 95723255 missense probably benign
R2033:Trpc1 UTSW 9 95706843 missense probably damaging 0.99
R2117:Trpc1 UTSW 9 95717584 missense probably damaging 1.00
R2262:Trpc1 UTSW 9 95706933 missense probably damaging 1.00
R2910:Trpc1 UTSW 9 95749842 missense probably benign 0.00
R2918:Trpc1 UTSW 9 95723129 missense probably damaging 1.00
R3156:Trpc1 UTSW 9 95721132 critical splice donor site probably null
R3427:Trpc1 UTSW 9 95732196 missense probably benign 0.12
R4093:Trpc1 UTSW 9 95706865 missense probably benign 0.12
R4384:Trpc1 UTSW 9 95732108 missense probably benign 0.13
R4787:Trpc1 UTSW 9 95721415 missense probably benign 0.02
R5327:Trpc1 UTSW 9 95721471 critical splice acceptor site probably null
R5576:Trpc1 UTSW 9 95721324 missense probably damaging 0.97
R6320:Trpc1 UTSW 9 95721250 missense probably damaging 1.00
R6499:Trpc1 UTSW 9 95726437 missense probably damaging 1.00
R6714:Trpc1 UTSW 9 95723273 missense probably damaging 1.00
R7179:Trpc1 UTSW 9 95721144 missense possibly damaging 0.82
R7265:Trpc1 UTSW 9 95708275 missense probably benign
R8169:Trpc1 UTSW 9 95710270 nonsense probably null
R8288:Trpc1 UTSW 9 95721381 missense probably damaging 1.00
X0026:Trpc1 UTSW 9 95732044 missense probably benign 0.36
Z1176:Trpc1 UTSW 9 95723216 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAGCATCACCTGAAGAATATCC -3'
(R):5'- TTACCAGGTTGCGCATTGA -3'

Sequencing Primer
(F):5'- CCCAAATTAAAAATACTGGTTCACAC -3'
(R):5'- ACATAGATGTACTACTGACTCTGGC -3'
Posted On2019-06-07