Incidental Mutation 'PIT4581001:Myrip'
ID556511
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Namemyosin VIIA and Rab interacting protein
SynonymsA230081N12Rik, Slac2-c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location120301513-120474841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120467517 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 831 (S831P)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
Predicted Effect probably damaging
Transcript: ENSMUST00000048121
AA Change: S831P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: S831P

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3237:Myrip UTSW 9 120441407 missense possibly damaging 0.91
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3912:Myrip UTSW 9 120432616 missense probably benign
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4126:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGAGGAGGTCCAGAACGTG -3'
(R):5'- GAGAGGAAGGTTGCCTCTTG -3'

Sequencing Primer
(F):5'- TCACATTGAGGAAAGCATACATG -3'
(R):5'- CCTCTTGGGGCTCTGCTGAG -3'
Posted On2019-06-07