Incidental Mutation 'PIT4581001:Zbtb2'
ID556512
Institutional Source Beutler Lab
Gene Symbol Zbtb2
Ensembl Gene ENSMUSG00000075327
Gene Namezinc finger and BTB domain containing 2
SynonymsLOC381990
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location4367075-4388108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4369265 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 254 (Y254H)
Ref Sequence ENSEMBL: ENSMUSP00000097655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100077] [ENSMUST00000100078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100077
AA Change: Y254H

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097655
Gene: ENSMUSG00000075327
AA Change: Y254H

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100078
AA Change: Y254H

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097656
Gene: ENSMUSG00000075327
AA Change: Y254H

DomainStartEndE-ValueType
BTB 24 117 1.45e-12 SMART
low complexity region 201 220 N/A INTRINSIC
ZnF_C2H2 254 276 4.87e-4 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 390 410 1.06e2 SMART
ZnF_C2H2 448 468 2.41e1 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Zbtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Zbtb2 APN 10 4369702 missense probably benign 0.28
IGL02340:Zbtb2 APN 10 4368712 missense probably damaging 0.98
PIT4142001:Zbtb2 UTSW 10 4369493 missense probably benign 0.00
R1436:Zbtb2 UTSW 10 4368697 missense probably benign 0.01
R2015:Zbtb2 UTSW 10 4369757 missense possibly damaging 0.94
R2570:Zbtb2 UTSW 10 4368673 missense probably damaging 1.00
R5134:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5275:Zbtb2 UTSW 10 4368508 missense probably damaging 1.00
R5286:Zbtb2 UTSW 10 4368566 missense possibly damaging 0.66
R5295:Zbtb2 UTSW 10 4368508 missense probably damaging 1.00
R5328:Zbtb2 UTSW 10 4369267 missense possibly damaging 0.48
R5475:Zbtb2 UTSW 10 4369275 missense probably benign 0.18
R5719:Zbtb2 UTSW 10 4369456 missense probably benign 0.22
R5907:Zbtb2 UTSW 10 4368592 missense possibly damaging 0.52
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6033:Zbtb2 UTSW 10 4368599 missense probably damaging 0.97
R6492:Zbtb2 UTSW 10 4369711 missense probably damaging 1.00
R7016:Zbtb2 UTSW 10 4368646 missense probably damaging 1.00
R7287:Zbtb2 UTSW 10 4368986 missense possibly damaging 0.77
R7348:Zbtb2 UTSW 10 4374574 missense possibly damaging 0.48
R7486:Zbtb2 UTSW 10 4369025 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTACTTCCAGAGCATCCTTGC -3'
(R):5'- CTGTCCCAGCTGACTTCAAAC -3'

Sequencing Primer
(F):5'- GCATCCTTGCCCAGGTC -3'
(R):5'- GGTGAATCGGACAAATATAACTCCCG -3'
Posted On2019-06-07