Incidental Mutation 'PIT4581001:Shprh'
ID 556513
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4581001 (G1)
Quality Score 217.468
Status Not validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) TAAAA to T at 11192494 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably null
Transcript: ENSMUST00000044053
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054814
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000159541
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159810
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
R8995:Shprh UTSW 10 11164830 nonsense probably null
R9053:Shprh UTSW 10 11154702 missense probably benign 0.04
R9131:Shprh UTSW 10 11162845 missense possibly damaging 0.58
R9176:Shprh UTSW 10 11160576 missense probably benign 0.02
R9391:Shprh UTSW 10 11162889 missense probably benign 0.05
R9423:Shprh UTSW 10 11205263 missense probably damaging 1.00
R9563:Shprh UTSW 10 11166491 nonsense probably null
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCATAACACTATAAGCTGTGG -3'
(R):5'- GACCCTACCTCTAACAGTTATGAG -3'

Sequencing Primer
(F):5'- GTGTGCTGAATAAATTCCAGAAATAG -3'
(R):5'- CTACCTCTAACAGTTATGAGAAAGTG -3'
Posted On 2019-06-07