Incidental Mutation 'PIT4581001:Slc17a4'
ID556525
Institutional Source Beutler Lab
Gene Symbol Slc17a4
Ensembl Gene ENSMUSG00000021336
Gene Namesolute carrier family 17 (sodium phosphate), member 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23895890-23915009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23902018 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 329 (S329T)
Ref Sequence ENSEMBL: ENSMUSP00000106037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021769] [ENSMUST00000110407] [ENSMUST00000225797]
Predicted Effect probably damaging
Transcript: ENSMUST00000021769
AA Change: S329T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021769
Gene: ENSMUSG00000021336
AA Change: S329T

DomainStartEndE-ValueType
Pfam:MFS_1 40 373 1.4e-48 PFAM
Pfam:MFS_1 361 492 2.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110407
AA Change: S329T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106037
Gene: ENSMUSG00000021336
AA Change: S329T

DomainStartEndE-ValueType
Pfam:MFS_1 40 371 1.7e-47 PFAM
Pfam:MFS_1 359 490 3.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225797
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphate homeostasis is maintained by regulating intake, intestinal absorption, bone deposition and resorption, and renal excretion of phosphate. The central molecule in the control of phosphate excretion from the kidney is the sodium/phosphate cotransporter NPT1 (SLC17A1; MIM 182308), which is located in the renal proximal tubule. NPT1 uses the transmembrane electrochemical potential gradient of sodium to transport phosphate across the cell membrane. SLC17A4 is a similar sodium/phosphate cotransporter in the intestinal mucosa that plays an important role in the absorption of phosphate from the intestine (summary by Shibui et al., 1999 [PubMed 10319585]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp595 A G 13: 67,317,885 S108P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Slc17a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Slc17a4 APN 13 23905533 missense probably benign 0.06
IGL02976:Slc17a4 APN 13 23905424 missense probably damaging 0.99
PIT4696001:Slc17a4 UTSW 13 23900514 missense probably benign 0.02
R1490:Slc17a4 UTSW 13 23904753 missense probably benign 0.29
R1726:Slc17a4 UTSW 13 23905591 nonsense probably null
R1866:Slc17a4 UTSW 13 23900545 missense possibly damaging 0.67
R3820:Slc17a4 UTSW 13 23901769 missense probably benign
R3821:Slc17a4 UTSW 13 23901769 missense probably benign
R3837:Slc17a4 UTSW 13 23901769 missense probably benign
R3838:Slc17a4 UTSW 13 23901769 missense probably benign
R3839:Slc17a4 UTSW 13 23901769 missense probably benign
R5347:Slc17a4 UTSW 13 23908817 missense possibly damaging 0.63
R5489:Slc17a4 UTSW 13 23898842 unclassified probably null
R6607:Slc17a4 UTSW 13 23905414 splice site probably null
R7614:Slc17a4 UTSW 13 23906597 missense probably benign 0.02
R7730:Slc17a4 UTSW 13 23900520 nonsense probably null
R7744:Slc17a4 UTSW 13 23901784 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GATTCCAGATGAGGCAAGGACC -3'
(R):5'- AGACCGTGATTGAGTGTCCAG -3'

Sequencing Primer
(F):5'- ATGAGGCAAGGACCCCTGC -3'
(R):5'- CAGACTTGGACCGTCAAT -3'
Posted On2019-06-07