Incidental Mutation 'PIT4581001:Zfp595'
ID556527
Institutional Source Beutler Lab
Gene Symbol Zfp595
Ensembl Gene ENSMUSG00000057842
Gene Namezinc finger protein 595
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4581001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67312998-67332570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67317885 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 108 (S108P)
Ref Sequence ENSEMBL: ENSMUSP00000105357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044819] [ENSMUST00000109735] [ENSMUST00000168892] [ENSMUST00000169142] [ENSMUST00000171466]
Predicted Effect probably benign
Transcript: ENSMUST00000044819
SMART Domains Protein: ENSMUSP00000049225
Gene: ENSMUSG00000098781

DomainStartEndE-ValueType
KRAB 5 65 1.15e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109735
AA Change: S108P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105357
Gene: ENSMUSG00000057842
AA Change: S108P

DomainStartEndE-ValueType
KRAB 5 65 1.57e-30 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 6.57e-1 SMART
ZnF_C2H2 137 159 4.38e1 SMART
ZnF_C2H2 165 187 2.91e-2 SMART
ZnF_C2H2 193 215 2.36e-2 SMART
ZnF_C2H2 221 243 2.79e-4 SMART
PHD 222 283 4.64e0 SMART
ZnF_C2H2 249 271 4.47e-3 SMART
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 4.54e-4 SMART
ZnF_C2H2 333 355 8.94e-3 SMART
PHD 334 395 1.2e1 SMART
ZnF_C2H2 361 383 2.02e-1 SMART
ZnF_C2H2 389 411 2.75e-3 SMART
ZnF_C2H2 417 439 1.26e-2 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
PHD 446 507 1.12e0 SMART
ZnF_C2H2 473 495 4.79e-3 SMART
ZnF_C2H2 501 523 2.09e-3 SMART
ZnF_C2H2 529 551 2.95e-3 SMART
ZnF_C2H2 557 579 5.14e-3 SMART
ZnF_C2H2 585 607 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168892
AA Change: S108P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126862
Gene: ENSMUSG00000057842
AA Change: S108P

DomainStartEndE-ValueType
KRAB 5 65 1.57e-30 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 6.57e-1 SMART
ZnF_C2H2 137 159 4.38e1 SMART
ZnF_C2H2 165 187 2.91e-2 SMART
ZnF_C2H2 193 215 2.36e-2 SMART
ZnF_C2H2 221 243 2.79e-4 SMART
PHD 222 283 4.64e0 SMART
ZnF_C2H2 249 271 4.47e-3 SMART
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 4.54e-4 SMART
ZnF_C2H2 333 355 8.94e-3 SMART
PHD 334 395 1.2e1 SMART
ZnF_C2H2 361 383 2.02e-1 SMART
ZnF_C2H2 389 411 2.75e-3 SMART
ZnF_C2H2 417 439 1.26e-2 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
PHD 446 507 1.12e0 SMART
ZnF_C2H2 473 495 4.79e-3 SMART
ZnF_C2H2 501 523 2.09e-3 SMART
ZnF_C2H2 529 551 2.95e-3 SMART
ZnF_C2H2 557 579 5.14e-3 SMART
ZnF_C2H2 585 607 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169142
AA Change: S108P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129905
Gene: ENSMUSG00000057842
AA Change: S108P

DomainStartEndE-ValueType
KRAB 5 65 1.57e-30 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 6.57e-1 SMART
ZnF_C2H2 137 159 4.38e1 SMART
ZnF_C2H2 165 187 2.91e-2 SMART
ZnF_C2H2 193 215 2.36e-2 SMART
ZnF_C2H2 221 243 2.79e-4 SMART
PHD 222 283 4.64e0 SMART
ZnF_C2H2 249 271 4.47e-3 SMART
ZnF_C2H2 277 299 7.26e-3 SMART
ZnF_C2H2 305 327 4.54e-4 SMART
ZnF_C2H2 333 355 8.94e-3 SMART
PHD 334 395 1.2e1 SMART
ZnF_C2H2 361 383 2.02e-1 SMART
ZnF_C2H2 389 411 2.75e-3 SMART
ZnF_C2H2 417 439 1.26e-2 SMART
ZnF_C2H2 445 467 1.04e-3 SMART
PHD 446 507 1.12e0 SMART
ZnF_C2H2 473 495 4.79e-3 SMART
ZnF_C2H2 501 523 2.09e-3 SMART
ZnF_C2H2 529 551 2.95e-3 SMART
ZnF_C2H2 557 579 5.14e-3 SMART
ZnF_C2H2 585 607 2.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171466
AA Change: S105P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127010
Gene: ENSMUSG00000057842
AA Change: S105P

DomainStartEndE-ValueType
KRAB 2 62 1.57e-30 SMART
ZnF_C2H2 78 100 2.09e-3 SMART
ZnF_C2H2 106 128 6.57e-1 SMART
ZnF_C2H2 134 156 4.38e1 SMART
ZnF_C2H2 162 184 2.91e-2 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 218 240 2.79e-4 SMART
PHD 219 280 4.64e0 SMART
ZnF_C2H2 246 268 4.47e-3 SMART
ZnF_C2H2 274 296 7.26e-3 SMART
ZnF_C2H2 302 324 4.54e-4 SMART
ZnF_C2H2 330 352 8.94e-3 SMART
PHD 331 392 1.2e1 SMART
ZnF_C2H2 358 380 2.02e-1 SMART
ZnF_C2H2 386 408 2.75e-3 SMART
ZnF_C2H2 414 436 1.26e-2 SMART
ZnF_C2H2 442 464 1.04e-3 SMART
PHD 443 504 1.12e0 SMART
ZnF_C2H2 470 492 4.79e-3 SMART
ZnF_C2H2 498 520 2.09e-3 SMART
ZnF_C2H2 526 548 2.95e-3 SMART
ZnF_C2H2 554 576 5.14e-3 SMART
ZnF_C2H2 582 604 2.95e-3 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.6%
  • 10x: 84.5%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the Cys2His2 zinc finger protein family, whose members function as transcription factors that can regulate a broad variety of developmental and cellular processes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,343,832 H522R probably benign Het
Adcy8 A T 15: 64,754,817 I724N probably damaging Het
BC117090 T C 16: 36,322,932 I52V probably benign Het
Ctsj A T 13: 61,002,556 C210S probably damaging Het
Cyp2d12 A G 15: 82,558,451 E365G probably damaging Het
Dbi A T 1: 120,119,912 V85E probably damaging Het
Dhrs7b A G 11: 60,851,897 I153M possibly damaging Het
Dock10 C A 1: 80,505,446 C2096F probably damaging Het
Eid3 T A 10: 82,867,755 I350K probably damaging Het
Fam83b A T 9: 76,491,152 F890I probably damaging Het
Fras1 G A 5: 96,555,301 D308N probably benign Het
Ftsj3 T C 11: 106,249,476 D822G unknown Het
Gabra5 T C 7: 57,488,857 T148A probably damaging Het
Gad1 A G 2: 70,599,667 D526G probably benign Het
Gm12184 A G 11: 48,826,144 I69T possibly damaging Het
Gm21698 T A 5: 25,987,352 T79S probably benign Het
Gon4l T G 3: 88,895,514 V1144G probably damaging Het
Ighv1-24 A T 12: 114,773,183 N32K probably benign Het
Islr T C 9: 58,157,201 N341S possibly damaging Het
Mybph A G 1: 134,194,741 T175A probably benign Het
Mycn T C 12: 12,940,243 K51E possibly damaging Het
Myh14 T C 7: 44,613,482 N1763D probably benign Het
Myrip T C 9: 120,467,517 S831P probably damaging Het
Neb G T 2: 52,288,802 A1314E probably damaging Het
Notch2 T C 3: 98,104,462 Y599H probably damaging Het
Npr1 C A 3: 90,462,257 G387V probably damaging Het
Olfr49 T A 14: 54,282,538 D119V probably damaging Het
Orai2 G A 5: 136,150,510 T223M probably damaging Het
Pcdhga5 A G 18: 37,696,857 E786G probably benign Het
Pde6b A G 5: 108,428,508 T749A probably benign Het
Pdzrn3 A G 6: 101,151,503 V734A probably benign Het
Pkd1l1 GCC GCCC 11: 8,916,298 probably null Het
Recql5 C A 11: 115,932,856 K21N possibly damaging Het
Rimbp3 G A 16: 17,210,716 S668N possibly damaging Het
Sdr42e1 A T 8: 117,663,518 I128N probably damaging Het
Shprh TAAAA T 10: 11,192,494 probably null Het
Slc15a2 A T 16: 36,772,043 C251S probably benign Het
Slc17a4 A T 13: 23,902,018 S329T probably damaging Het
Slc35a1 A G 4: 34,669,501 V246A possibly damaging Het
Slc37a2 A T 9: 37,237,405 S260R probably benign Het
Slco6d1 A T 1: 98,423,325 I177L possibly damaging Het
Tmcc1 A G 6: 116,043,456 V345A Het
Tmod2 T C 9: 75,597,301 Y12C probably damaging Het
Top2a A T 11: 99,002,964 W1035R probably damaging Het
Trpc1 A G 9: 95,736,921 S126P probably benign Het
Ttn A G 2: 76,733,961 S28576P probably damaging Het
Vmn1r16 A T 6: 57,322,873 W255R probably benign Het
Vmn2r5 T A 3: 64,503,927 K407* probably null Het
Vps13b G T 15: 35,534,263 W908C probably damaging Het
Ykt6 A G 11: 5,962,747 K150E possibly damaging Het
Zbtb2 A G 10: 4,369,265 Y254H possibly damaging Het
Zfp217 A G 2: 170,114,583 S832P probably benign Het
Zfp786 A T 6: 47,819,822 F727L probably damaging Het
Zzef1 G A 11: 72,899,672 V2151I probably benign Het
Other mutations in Zfp595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Zfp595 APN 13 67316685 nonsense probably null
IGL01572:Zfp595 APN 13 67317401 missense possibly damaging 0.58
IGL01836:Zfp595 APN 13 67332461 utr 5 prime probably benign
IGL01924:Zfp595 APN 13 67317783 missense possibly damaging 0.93
IGL02171:Zfp595 APN 13 67316655 missense possibly damaging 0.61
IGL02376:Zfp595 APN 13 67316450 missense possibly damaging 0.80
IGL02651:Zfp595 APN 13 67320953 missense probably benign 0.00
R0071:Zfp595 UTSW 13 67316853 missense possibly damaging 0.55
R0111:Zfp595 UTSW 13 67320920 missense possibly damaging 0.90
R0319:Zfp595 UTSW 13 67316513 missense possibly damaging 0.92
R0491:Zfp595 UTSW 13 67317305 missense probably damaging 0.99
R1162:Zfp595 UTSW 13 67317195 missense probably damaging 1.00
R1559:Zfp595 UTSW 13 67317063 missense possibly damaging 0.93
R3118:Zfp595 UTSW 13 67320899 missense probably benign 0.00
R3901:Zfp595 UTSW 13 67317315 missense probably benign 0.13
R4738:Zfp595 UTSW 13 67317165 missense probably benign 0.11
R4866:Zfp595 UTSW 13 67317696 missense probably damaging 1.00
R4993:Zfp595 UTSW 13 67316401 missense probably damaging 0.99
R5987:Zfp595 UTSW 13 67317624 missense probably damaging 1.00
R6684:Zfp595 UTSW 13 67320277 missense probably damaging 1.00
R7099:Zfp595 UTSW 13 67317647 missense probably damaging 1.00
R7593:Zfp595 UTSW 13 67316759 missense probably benign 0.00
R7657:Zfp595 UTSW 13 67317753 missense probably damaging 1.00
R7828:Zfp595 UTSW 13 67317705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTTAGAAAGGAATAATGAAGTGC -3'
(R):5'- ATGCAAGTGAGTAAATGTTGGTTTT -3'

Sequencing Primer
(F):5'- GCCACATACTTCACAGTTGTAGGG -3'
(R):5'- CTCAACTCTTACTCACCAGG -3'
Posted On2019-06-07