Incidental Mutation 'R0605:Dmxl2'
ID 55654
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene Name Dmx-like 2
Synonyms E130119P06Rik, 6430411K14Rik
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0605 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 54272442-54408910 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54327229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 758 (D758G)
Ref Sequence ENSEMBL: ENSMUSP00000122293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118163
AA Change: D932G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: D932G

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118600
AA Change: D932G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: D932G

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect unknown
Transcript: ENSMUST00000123709
AA Change: D133G
SMART Domains Protein: ENSMUSP00000119959
Gene: ENSMUSG00000041268
AA Change: D133G

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
WD40 187 231 1.15e1 SMART
WD40 438 475 2.84e2 SMART
Pfam:Rav1p_C 632 1105 9.1e-72 PFAM
low complexity region 1180 1195 N/A INTRINSIC
coiled coil region 1319 1347 N/A INTRINSIC
low complexity region 1391 1406 N/A INTRINSIC
low complexity region 1453 1468 N/A INTRINSIC
low complexity region 1674 1692 N/A INTRINSIC
low complexity region 1925 1947 N/A INTRINSIC
WD40 1955 1990 5.73e0 SMART
WD40 1994 2033 8.88e0 SMART
WD40 2040 2082 2.67e-1 SMART
WD40 2088 2127 2.57e-2 SMART
WD40 2130 2169 3.61e-6 SMART
WD40 2182 2220 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127880
AA Change: D758G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268
AA Change: D758G

DomainStartEndE-ValueType
Pfam:WD40 1 24 7.9e-4 PFAM
WD40 47 95 1.03e-1 SMART
low complexity region 246 266 N/A INTRINSIC
WD40 567 619 1.42e2 SMART
low complexity region 687 701 N/A INTRINSIC
low complexity region 771 787 N/A INTRINSIC
WD40 811 855 1.15e1 SMART
WD40 1062 1099 2.84e2 SMART
low complexity region 1252 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144736
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Peak1 C T 9: 56,134,382 (GRCm39) probably benign Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54,308,988 (GRCm39) missense probably benign
IGL00226:Dmxl2 APN 9 54,323,277 (GRCm39) missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54,313,951 (GRCm39) missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54,358,122 (GRCm39) missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54,322,706 (GRCm39) unclassified probably benign
IGL00852:Dmxl2 APN 9 54,330,597 (GRCm39) nonsense probably null
IGL00857:Dmxl2 APN 9 54,283,604 (GRCm39) missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54,324,166 (GRCm39) missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54,366,248 (GRCm39) missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54,322,759 (GRCm39) missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54,352,660 (GRCm39) splice site probably benign
IGL01645:Dmxl2 APN 9 54,286,017 (GRCm39) missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54,308,349 (GRCm39) missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54,311,299 (GRCm39) nonsense probably null
IGL02145:Dmxl2 APN 9 54,281,981 (GRCm39) missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54,311,333 (GRCm39) missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54,352,717 (GRCm39) missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54,301,052 (GRCm39) missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54,301,127 (GRCm39) missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54,301,032 (GRCm39) missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54,313,899 (GRCm39) missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54,273,698 (GRCm39) utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54,324,229 (GRCm39) missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54,311,456 (GRCm39) missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54,323,655 (GRCm39) missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54,311,504 (GRCm39) missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54,353,956 (GRCm39) missense probably damaging 1.00
BB003:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
BB013:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
I2288:Dmxl2 UTSW 9 54,309,077 (GRCm39) missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54,309,048 (GRCm39) missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54,286,223 (GRCm39) missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54,307,224 (GRCm39) critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54,324,235 (GRCm39) missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54,291,034 (GRCm39) missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54,301,120 (GRCm39) missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54,313,190 (GRCm39) missense possibly damaging 0.95
R0625:Dmxl2 UTSW 9 54,289,986 (GRCm39) missense probably benign
R0626:Dmxl2 UTSW 9 54,323,838 (GRCm39) missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54,286,101 (GRCm39) missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54,313,112 (GRCm39) missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54,273,724 (GRCm39) missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54,353,696 (GRCm39) missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54,275,049 (GRCm39) missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54,323,717 (GRCm39) missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54,303,533 (GRCm39) missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54,322,712 (GRCm39) critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R1609:Dmxl2 UTSW 9 54,316,547 (GRCm39) missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54,289,311 (GRCm39) missense probably benign
R1660:Dmxl2 UTSW 9 54,358,314 (GRCm39) missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54,308,769 (GRCm39) missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54,330,508 (GRCm39) splice site probably benign
R1832:Dmxl2 UTSW 9 54,368,233 (GRCm39) missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54,308,807 (GRCm39) missense probably benign
R2104:Dmxl2 UTSW 9 54,322,848 (GRCm39) missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54,301,097 (GRCm39) missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54,323,194 (GRCm39) missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54,283,527 (GRCm39) missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54,301,146 (GRCm39) missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54,307,378 (GRCm39) missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54,300,986 (GRCm39) missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54,384,745 (GRCm39) missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54,300,927 (GRCm39) missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54,301,053 (GRCm39) missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54,277,162 (GRCm39) missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54,381,116 (GRCm39) splice site probably benign
R4004:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54,353,674 (GRCm39) missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54,286,297 (GRCm39) splice site probably null
R4014:Dmxl2 UTSW 9 54,285,993 (GRCm39) splice site probably null
R4115:Dmxl2 UTSW 9 54,354,272 (GRCm39) nonsense probably null
R4232:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54,303,551 (GRCm39) missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54,327,168 (GRCm39) missense probably null 0.17
R4552:Dmxl2 UTSW 9 54,359,047 (GRCm39) missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54,353,796 (GRCm39) missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54,354,189 (GRCm39) missense probably benign 0.04
R4711:Dmxl2 UTSW 9 54,358,208 (GRCm39) missense probably benign 0.37
R4715:Dmxl2 UTSW 9 54,353,689 (GRCm39) splice site probably null
R4746:Dmxl2 UTSW 9 54,359,080 (GRCm39) missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54,287,099 (GRCm39) missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54,311,325 (GRCm39) missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54,318,937 (GRCm39) missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54,408,725 (GRCm39) utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54,368,271 (GRCm39) missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54,352,768 (GRCm39) splice site probably null
R5288:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5373:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5374:Dmxl2 UTSW 9 54,276,473 (GRCm39) intron probably benign
R5385:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5386:Dmxl2 UTSW 9 54,286,041 (GRCm39) missense probably benign
R5418:Dmxl2 UTSW 9 54,281,935 (GRCm39) critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54,301,141 (GRCm39) missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54,330,643 (GRCm39) splice site probably null
R5733:Dmxl2 UTSW 9 54,283,550 (GRCm39) missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54,380,248 (GRCm39) missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54,282,792 (GRCm39) missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54,294,704 (GRCm39) missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54,300,957 (GRCm39) missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54,324,037 (GRCm39) missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54,301,011 (GRCm39) missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54,323,046 (GRCm39) missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54,289,990 (GRCm39) missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54,327,193 (GRCm39) missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54,282,820 (GRCm39) missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54,323,960 (GRCm39) missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54,318,908 (GRCm39) missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54,323,372 (GRCm39) missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54,323,808 (GRCm39) missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54,316,467 (GRCm39) missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54,387,664 (GRCm39) missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54,379,496 (GRCm39) missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54,358,163 (GRCm39) missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54,324,013 (GRCm39) missense probably benign 0.06
R7327:Dmxl2 UTSW 9 54,308,869 (GRCm39) missense probably damaging 1.00
R7462:Dmxl2 UTSW 9 54,273,916 (GRCm39) splice site probably null
R7526:Dmxl2 UTSW 9 54,308,241 (GRCm39) missense possibly damaging 0.47
R7569:Dmxl2 UTSW 9 54,323,271 (GRCm39) missense possibly damaging 0.51
R7622:Dmxl2 UTSW 9 54,379,502 (GRCm39) missense probably damaging 0.99
R7638:Dmxl2 UTSW 9 54,365,078 (GRCm39) missense unknown
R7703:Dmxl2 UTSW 9 54,368,370 (GRCm39) missense probably benign 0.01
R7768:Dmxl2 UTSW 9 54,288,223 (GRCm39) missense probably damaging 1.00
R7926:Dmxl2 UTSW 9 54,335,326 (GRCm39) missense probably benign 0.01
R7969:Dmxl2 UTSW 9 54,354,165 (GRCm39) missense possibly damaging 0.85
R8007:Dmxl2 UTSW 9 54,290,975 (GRCm39) nonsense probably null
R8200:Dmxl2 UTSW 9 54,387,630 (GRCm39) missense probably benign
R8311:Dmxl2 UTSW 9 54,354,217 (GRCm39) missense probably benign 0.00
R8320:Dmxl2 UTSW 9 54,291,043 (GRCm39) missense probably benign
R8377:Dmxl2 UTSW 9 54,286,032 (GRCm39) missense probably damaging 1.00
R8400:Dmxl2 UTSW 9 54,291,037 (GRCm39) missense probably benign 0.03
R8509:Dmxl2 UTSW 9 54,335,341 (GRCm39) nonsense probably null
R8698:Dmxl2 UTSW 9 54,281,953 (GRCm39) missense probably benign 0.10
R8768:Dmxl2 UTSW 9 54,301,105 (GRCm39) missense possibly damaging 0.83
R8770:Dmxl2 UTSW 9 54,311,298 (GRCm39) missense probably benign 0.01
R8799:Dmxl2 UTSW 9 54,327,027 (GRCm39) critical splice donor site probably null
R8840:Dmxl2 UTSW 9 54,309,139 (GRCm39) missense possibly damaging 0.58
R8898:Dmxl2 UTSW 9 54,308,941 (GRCm39) missense probably benign 0.01
R8954:Dmxl2 UTSW 9 54,381,156 (GRCm39) missense probably benign 0.04
R9083:Dmxl2 UTSW 9 54,316,548 (GRCm39) missense probably benign 0.29
R9114:Dmxl2 UTSW 9 54,307,321 (GRCm39) missense
R9115:Dmxl2 UTSW 9 54,309,011 (GRCm39) missense probably benign
R9263:Dmxl2 UTSW 9 54,358,945 (GRCm39) missense probably benign 0.01
R9272:Dmxl2 UTSW 9 54,311,404 (GRCm39) missense possibly damaging 0.55
R9577:Dmxl2 UTSW 9 54,323,664 (GRCm39) missense unknown
R9673:Dmxl2 UTSW 9 54,294,840 (GRCm39) missense probably damaging 1.00
R9722:Dmxl2 UTSW 9 54,323,892 (GRCm39) missense probably benign 0.00
R9726:Dmxl2 UTSW 9 54,322,996 (GRCm39) missense probably benign 0.09
R9797:Dmxl2 UTSW 9 54,358,187 (GRCm39) missense probably benign 0.00
X0064:Dmxl2 UTSW 9 54,308,997 (GRCm39) missense probably benign
Z1177:Dmxl2 UTSW 9 54,289,318 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCATTGCAGCACATGCATTGGAAG -3'
(R):5'- AGCAAGGAGTCCAAAAGTTGTCTCTC -3'

Sequencing Primer
(F):5'- ctcagtctcaacaacactttacc -3'
(R):5'- CCAAAAGTTGTCTCTCAAAAAGTGG -3'
Posted On 2013-07-11