Incidental Mutation 'PIT4677001:Ino80'
ID556541
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #PIT4677001 (G1)
Quality Score193.009
Status Not validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119377545 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1422 (V1422M)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920]
Predicted Effect probably benign
Transcript: ENSMUST00000049920
AA Change: V1422M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: V1422M

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T A 2: 127,187,013 T89S probably benign Het
4921517D22Rik A T 13: 59,690,491 F176I probably benign Het
Acsm3 A G 7: 119,775,117 D264G probably damaging Het
Adamts12 T A 15: 11,286,810 F834I probably benign Het
Arhgap45 A T 10: 80,020,749 M171L probably benign Het
Arid5b A T 10: 68,098,011 M687K probably damaging Het
AU040320 A T 4: 126,792,237 Q202L probably benign Het
Ccdc47 A G 11: 106,208,208 L219P probably damaging Het
Cfhr2 T G 1: 139,805,379 S301R unknown Het
Cog2 T A 8: 124,545,271 V508E probably benign Het
Cpb2 A G 14: 75,256,023 T47A probably benign Het
Ddx60 A T 8: 61,972,254 K692I possibly damaging Het
Defb34 A T 8: 19,126,396 R34S possibly damaging Het
Fads2 A T 19: 10,070,330 I275N probably damaging Het
Fam196b A T 11: 34,403,122 N388I probably benign Het
Fmn2 T G 1: 174,647,133 S1221A probably damaging Het
Fndc3a A T 14: 72,574,595 V302E probably benign Het
Galntl6 C T 8: 57,857,587 C360Y probably damaging Het
Gm14025 T C 2: 129,038,716 D430G Het
Gm16519 A T 17: 70,929,511 I152F probably benign Het
Hnrnpr T A 4: 136,329,439 V250D probably damaging Het
Hs3st6 A G 17: 24,758,311 D255G possibly damaging Het
Kcnu1 A G 8: 25,905,993 I669V probably benign Het
Layn A T 9: 51,057,411 V344E probably damaging Het
Mgll A T 6: 88,825,681 R273W possibly damaging Het
Myh2 G A 11: 67,181,992 S636N probably benign Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Pkd1 T G 17: 24,574,029 S1563R possibly damaging Het
Ppp4r3b G A 11: 29,187,978 V109I probably benign Het
Prdm2 A T 4: 143,135,078 D547E probably damaging Het
Prss46 A T 9: 110,856,030 M241L probably benign Het
Ptprf T A 4: 118,213,612 I1397F probably damaging Het
Pus10 A T 11: 23,720,171 T418S possibly damaging Het
Qsox2 T C 2: 26,222,308 D74G probably damaging Het
Sctr T C 1: 120,061,904 V383A probably damaging Het
Siglec1 T A 2: 131,072,757 N1480Y probably damaging Het
Skint2 T C 4: 112,625,938 I180T probably benign Het
Snd1 A G 6: 28,880,296 I690V probably benign Het
Spire1 T C 18: 67,491,365 T575A probably damaging Het
Srbd1 G A 17: 86,115,212 R459* probably null Het
Tll2 C A 19: 41,130,558 V244L probably benign Het
Tmem60 A G 5: 20,886,368 I44V probably benign Het
Ttc30a1 A G 2: 75,979,769 Y657H possibly damaging Het
Utrn T A 10: 12,666,704 I1846F probably benign Het
Vps8 T C 16: 21,500,334 F641S possibly damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACCAACCTTTAGACACATTG -3'
(R):5'- CCCAAATGTCCTCAGATCTCAGTG -3'

Sequencing Primer
(F):5'- TTGTACCCGTATGCAGCATAAGC -3'
(R):5'- ATGTCCTCAGATCTCAGTGAGTCAG -3'
Posted On2019-06-07