Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4677001:Ino80'

556541

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

PIT4677001 (G1)

Quality Score

193.009

Status

Not validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119377545 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1422 (V1422M)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

Predicted Effect

probably benign
Transcript: ENSMUST00000049920
AA Change: V1422M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: V1422M

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Coding Region Coverage

1x: 93.3%
3x: 90.8%
10x: 84.5%
20x: 71.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810024B03Rik	T	A	2: 127,187,013	T89S	probably benign	Het
4921517D22Rik	A	T	13: 59,690,491	F176I	probably benign	Het
Acsm3	A	G	7: 119,775,117	D264G	probably damaging	Het
Adamts12	T	A	15: 11,286,810	F834I	probably benign	Het
Arhgap45	A	T	10: 80,020,749	M171L	probably benign	Het
Arid5b	A	T	10: 68,098,011	M687K	probably damaging	Het
AU040320	A	T	4: 126,792,237	Q202L	probably benign	Het
Ccdc47	A	G	11: 106,208,208	L219P	probably damaging	Het
Cfhr2	T	G	1: 139,805,379	S301R	unknown	Het
Cog2	T	A	8: 124,545,271	V508E	probably benign	Het
Cpb2	A	G	14: 75,256,023	T47A	probably benign	Het
Ddx60	A	T	8: 61,972,254	K692I	possibly damaging	Het
Defb34	A	T	8: 19,126,396	R34S	possibly damaging	Het
Fads2	A	T	19: 10,070,330	I275N	probably damaging	Het
Fam196b	A	T	11: 34,403,122	N388I	probably benign	Het
Fmn2	T	G	1: 174,647,133	S1221A	probably damaging	Het
Fndc3a	A	T	14: 72,574,595	V302E	probably benign	Het
Galntl6	C	T	8: 57,857,587	C360Y	probably damaging	Het
Gm14025	T	C	2: 129,038,716	D430G		Het
Gm16519	A	T	17: 70,929,511	I152F	probably benign	Het
Hnrnpr	T	A	4: 136,329,439	V250D	probably damaging	Het
Hs3st6	A	G	17: 24,758,311	D255G	possibly damaging	Het
Kcnu1	A	G	8: 25,905,993	I669V	probably benign	Het
Layn	A	T	9: 51,057,411	V344E	probably damaging	Het
Mgll	A	T	6: 88,825,681	R273W	possibly damaging	Het
Myh2	G	A	11: 67,181,992	S636N	probably benign	Het
Nmur2	A	T	11: 56,033,009	S240T	probably benign	Het
Pkd1	T	G	17: 24,574,029	S1563R	possibly damaging	Het
Ppp4r3b	G	A	11: 29,187,978	V109I	probably benign	Het
Prdm2	A	T	4: 143,135,078	D547E	probably damaging	Het
Prss46	A	T	9: 110,856,030	M241L	probably benign	Het
Ptprf	T	A	4: 118,213,612	I1397F	probably damaging	Het
Pus10	A	T	11: 23,720,171	T418S	possibly damaging	Het
Qsox2	T	C	2: 26,222,308	D74G	probably damaging	Het
Sctr	T	C	1: 120,061,904	V383A	probably damaging	Het
Siglec1	T	A	2: 131,072,757	N1480Y	probably damaging	Het
Skint2	T	C	4: 112,625,938	I180T	probably benign	Het
Snd1	A	G	6: 28,880,296	I690V	probably benign	Het
Spire1	T	C	18: 67,491,365	T575A	probably damaging	Het
Srbd1	G	A	17: 86,115,212	R459*	probably null	Het
Tll2	C	A	19: 41,130,558	V244L	probably benign	Het
Tmem60	A	G	5: 20,886,368	I44V	probably benign	Het
Ttc30a1	A	G	2: 75,979,769	Y657H	possibly damaging	Het
Utrn	T	A	10: 12,666,704	I1846F	probably benign	Het
Vps8	T	C	16: 21,500,334	F641S	possibly damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCACCAACCTTTAGACACATTG -3'
(R):5'- CCCAAATGTCCTCAGATCTCAGTG -3'

Sequencing Primer
(F):5'- TTGTACCCGTATGCAGCATAAGC -3'
(R):5'- ATGTCCTCAGATCTCAGTGAGTCAG -3'

Posted On

2019-06-07