Incidental Mutation 'PIT4677001:1810024B03Rik'
ID556542
Institutional Source Beutler Lab
Gene Symbol 1810024B03Rik
Ensembl Gene ENSMUSG00000044145
Gene NameRIKEN cDNA 1810024B03 gene
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #PIT4677001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127186355-127208280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127187013 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 89 (T89S)
Ref Sequence ENSEMBL: ENSMUSP00000061355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056146]
Predicted Effect probably benign
Transcript: ENSMUST00000056146
AA Change: T89S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000061355
Gene: ENSMUSG00000044145
AA Change: T89S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 1.5e-30 PFAM
Pfam:Pkinase 1 189 2.1e-46 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 71.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,491 F176I probably benign Het
Acsm3 A G 7: 119,775,117 D264G probably damaging Het
Adamts12 T A 15: 11,286,810 F834I probably benign Het
Arhgap45 A T 10: 80,020,749 M171L probably benign Het
Arid5b A T 10: 68,098,011 M687K probably damaging Het
AU040320 A T 4: 126,792,237 Q202L probably benign Het
Ccdc47 A G 11: 106,208,208 L219P probably damaging Het
Cfhr2 T G 1: 139,805,379 S301R unknown Het
Cog2 T A 8: 124,545,271 V508E probably benign Het
Cpb2 A G 14: 75,256,023 T47A probably benign Het
Ddx60 A T 8: 61,972,254 K692I possibly damaging Het
Defb34 A T 8: 19,126,396 R34S possibly damaging Het
Fads2 A T 19: 10,070,330 I275N probably damaging Het
Fam196b A T 11: 34,403,122 N388I probably benign Het
Fmn2 T G 1: 174,647,133 S1221A probably damaging Het
Fndc3a A T 14: 72,574,595 V302E probably benign Het
Galntl6 C T 8: 57,857,587 C360Y probably damaging Het
Gm14025 T C 2: 129,038,716 D430G Het
Gm16519 A T 17: 70,929,511 I152F probably benign Het
Hnrnpr T A 4: 136,329,439 V250D probably damaging Het
Hs3st6 A G 17: 24,758,311 D255G possibly damaging Het
Ino80 C T 2: 119,377,545 V1422M probably benign Het
Kcnu1 A G 8: 25,905,993 I669V probably benign Het
Layn A T 9: 51,057,411 V344E probably damaging Het
Mgll A T 6: 88,825,681 R273W possibly damaging Het
Myh2 G A 11: 67,181,992 S636N probably benign Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Pkd1 T G 17: 24,574,029 S1563R possibly damaging Het
Ppp4r3b G A 11: 29,187,978 V109I probably benign Het
Prdm2 A T 4: 143,135,078 D547E probably damaging Het
Prss46 A T 9: 110,856,030 M241L probably benign Het
Ptprf T A 4: 118,213,612 I1397F probably damaging Het
Pus10 A T 11: 23,720,171 T418S possibly damaging Het
Qsox2 T C 2: 26,222,308 D74G probably damaging Het
Sctr T C 1: 120,061,904 V383A probably damaging Het
Siglec1 T A 2: 131,072,757 N1480Y probably damaging Het
Skint2 T C 4: 112,625,938 I180T probably benign Het
Snd1 A G 6: 28,880,296 I690V probably benign Het
Spire1 T C 18: 67,491,365 T575A probably damaging Het
Srbd1 G A 17: 86,115,212 R459* probably null Het
Tll2 C A 19: 41,130,558 V244L probably benign Het
Tmem60 A G 5: 20,886,368 I44V probably benign Het
Ttc30a1 A G 2: 75,979,769 Y657H possibly damaging Het
Utrn T A 10: 12,666,704 I1846F probably benign Het
Vps8 T C 16: 21,500,334 F641S possibly damaging Het
Other mutations in 1810024B03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:1810024B03Rik APN 2 127186955 missense probably damaging 1.00
IGL02124:1810024B03Rik APN 2 127186734 missense possibly damaging 0.82
R0417:1810024B03Rik UTSW 2 127186944 missense probably damaging 1.00
R0554:1810024B03Rik UTSW 2 127187276 start codon destroyed probably null 1.00
R4603:1810024B03Rik UTSW 2 127187099 missense probably damaging 1.00
R5396:1810024B03Rik UTSW 2 127186953 missense probably damaging 1.00
R5875:1810024B03Rik UTSW 2 127186817 missense possibly damaging 0.51
R7729:1810024B03Rik UTSW 2 127186790 missense possibly damaging 0.91
X0027:1810024B03Rik UTSW 2 127186772 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCGATATGGAATCCACCAG -3'
(R):5'- GGGGATCCCTGCTGAAATACATC -3'

Sequencing Primer
(F):5'- CCAGCTCTGGGATAGTATCATGTAC -3'
(R):5'- CAAAAAGCGTCGGCCTCTAGATG -3'
Posted On2019-06-07