Mutagenetix > Incidental Mutation

Incidental Mutation 'R0605:Scaper'

55655

Institutional Source

Beutler Lab

Gene Symbol

Scaper

Ensembl Gene

ENSMUSG00000034007

Gene Name

S phase cyclin A-associated protein in the ER

Synonyms

D530014O03Rik, Zfp291

MMRRC Submission

038794-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.654) question?

Stock #

R0605 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

55549879-55938119 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 55815518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]

AlphaFold

F8VQ70

Predicted Effect

probably benign
Transcript: ENSMUST00000037408

SMART Domains

Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007

Domain	Start	End	E-Value	Type
Pfam:SCAPER_N	88	185	3.4e-47	PFAM
low complexity region	323	338	N/A	INTRINSIC
coiled coil region	415	466	N/A	INTRINSIC
coiled coil region	535	597	N/A	INTRINSIC
SCOP:d1eq1a_	605	769	3e-6	SMART
ZnF_C2H2	791	815	1.16e1	SMART
low complexity region	866	883	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000214747

Predicted Effect

probably benign
Transcript: ENSMUST00000216595

Predicted Effect

probably benign
Transcript: ENSMUST00000217647

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.4%

Validation Efficiency

100% (85/85)

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933406P04Rik	G	A	10: 20,311,227		probably benign	Het
Adam28	A	T	14: 68,606,600		probably benign	Het
Adamts3	A	G	5: 89,861,475	W110R	possibly damaging	Het
Add1	T	C	5: 34,614,224	V342A	possibly damaging	Het
Aff3	A	G	1: 38,209,987	S680P	probably damaging	Het
Ak9	T	C	10: 41,345,139	Y322H	probably damaging	Het
Als2	A	G	1: 59,168,414	L1528S	probably benign	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atp6v1a	A	C	16: 44,111,496		probably null	Het
Bpi	T	C	2: 158,261,394	L103P	probably damaging	Het
Cd80	G	A	16: 38,482,694	V168I	probably benign	Het
Cfh	T	C	1: 140,102,358	S926G	probably damaging	Het
Chrd	A	T	16: 20,735,439	T304S	probably damaging	Het
Chsy3	A	G	18: 59,409,053	Y421C	probably damaging	Het
Cmbl	T	G	15: 31,585,309	V101G	probably damaging	Het
Colgalt2	T	A	1: 152,495,792		probably benign	Het
Coq4	C	T	2: 29,789,998	Q101*	probably null	Het
Cr2	T	C	1: 195,163,596		probably benign	Het
Cry1	T	C	10: 85,184,359	D38G	probably damaging	Het
Dmxl2	T	C	9: 54,419,945	D758G	probably benign	Het
Epsti1	C	T	14: 77,927,237		probably benign	Het
Fam24b	T	C	7: 131,327,186		probably benign	Het
Fem1c	G	A	18: 46,505,160	R592C	probably benign	Het
Foxred1	T	C	9: 35,204,882	Y490C	possibly damaging	Het
Gm14124	A	G	2: 150,268,603	I404M	unknown	Het
Gm9875	A	G	2: 13,557,888	K9R	unknown	Het
Grid2ip	T	C	5: 143,379,362	S322P	probably damaging	Het
Gucy1b2	A	G	14: 62,403,159		probably benign	Het
Hmcn1	A	T	1: 150,657,376		probably null	Het
Hpdl	C	T	4: 116,820,787	S159N	possibly damaging	Het
Hsd17b12	A	T	2: 94,033,642	M285K	probably benign	Het
Icam5	T	C	9: 21,032,197	I23T	probably benign	Het
Kat5	A	G	19: 5,608,336		probably benign	Het
Lama3	A	G	18: 12,506,949	N67S	probably benign	Het
Lamb2	T	C	9: 108,486,105		probably benign	Het
Lgals3bp	A	G	11: 118,393,394	F453S	probably damaging	Het
Lypd4	A	G	7: 24,865,375	Y113H	probably damaging	Het
Mdm1	C	T	10: 118,146,601	T47M	probably damaging	Het
Mei1	C	A	15: 82,070,150	T52K	probably benign	Het
Meiob	G	A	17: 24,818,262		probably benign	Het
Ndufaf6	A	G	4: 11,051,224	V292A	probably damaging	Het
Neb	T	A	2: 52,264,026	M2358L	possibly damaging	Het
Nlrp1b	A	G	11: 71,156,179	S1119P	possibly damaging	Het
Nsmaf	A	G	4: 6,418,470		probably null	Het
Ogfod1	T	C	8: 94,047,267		probably benign	Het
Olfr1097	T	C	2: 86,890,419	Y252C	possibly damaging	Het
Olfr1410	G	T	1: 92,607,896	V20L	probably benign	Het
Olfr291	T	C	7: 84,857,137	I256T	probably damaging	Het
Osbpl1a	T	A	18: 12,882,279		probably null	Het
Otud7b	T	A	3: 96,144,959		probably benign	Het
P3h3	T	A	6: 124,856,035	H185L	probably damaging	Het
P4htm	G	A	9: 108,583,724	A183V	probably null	Het
Peak1	C	T	9: 56,227,098		probably benign	Het
Phf20l1	A	G	15: 66,595,122	K88R	probably damaging	Het
Phlpp2	A	G	8: 109,933,211	N721S	probably benign	Het
Plagl2	T	C	2: 153,235,944	K39R	probably benign	Het
Plppr1	A	T	4: 49,323,466	N252I	probably damaging	Het
Pom121l2	C	T	13: 21,982,036	A159V	probably damaging	Het
Prom2	C	A	2: 127,539,995		probably null	Het
Prrc2c	T	C	1: 162,682,426	T1017A	probably damaging	Het
Rimbp3	G	T	16: 17,211,699	A996S	probably damaging	Het
Rnf213	A	G	11: 119,431,717	T1387A	probably benign	Het
Scara5	A	G	14: 65,759,648	E403G	possibly damaging	Het
Scrib	T	C	15: 76,067,553	I94V	possibly damaging	Het
Shank3	T	C	15: 89,524,147	F67L	possibly damaging	Het
Shprh	T	C	10: 11,207,112	F1562L	probably damaging	Het
Src	C	T	2: 157,469,921	T529M	probably damaging	Het
Sycp2l	T	A	13: 41,143,466	M341K	probably benign	Het
Syde1	T	C	10: 78,589,095		probably benign	Het
Tarsl2	A	T	7: 65,678,071	R509S	probably damaging	Het
Tle6	T	A	10: 81,594,346	H324L	probably damaging	Het
Tnfaip8	ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	18: 50,046,845		probably benign	Het
Tnfrsf14	T	A	4: 154,925,380	K115*	probably null	Het
Trappc10	T	C	10: 78,201,497	N824S	possibly damaging	Het
Tsc1	C	T	2: 28,671,778	S309F	probably damaging	Het
Ttc21a	A	G	9: 119,961,842	I885V	possibly damaging	Het
Ttn	C	T	2: 76,740,453	A26699T	probably damaging	Het
Ttn	T	C	2: 76,948,371	Y1262C	unknown	Het
Usp49	T	C	17: 47,674,926		probably null	Het
Vmn1r226	A	T	17: 20,687,871	T122S	probably benign	Het
Vps8	A	T	16: 21,559,337	T1033S	probably benign	Het
Vwf	C	A	6: 125,685,837	T2728K	probably benign	Het
Wdr5b	T	C	16: 36,041,996	S162P	probably benign	Het
Xrn1	C	T	9: 96,026,877	Q1235*	probably null	Het

Other mutations in Scaper

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00653:Scaper	APN	9	55859859	missense	probably damaging	0.99
IGL00912:Scaper	APN	9	55685955	missense	probably damaging	1.00
IGL01469:Scaper	APN	9	55859767	missense	probably damaging	1.00
IGL01626:Scaper	APN	9	55912051	missense	possibly damaging	0.61
IGL01779:Scaper	APN	9	55892240	missense	probably benign	0.20
IGL02011:Scaper	APN	9	55580322	missense	probably damaging	1.00
IGL02997:Scaper	APN	9	55815499	missense	probably damaging	1.00
IGL03107:Scaper	APN	9	55858402	splice site	probably benign
IGL03167:Scaper	APN	9	55859824	missense	probably damaging	1.00
IGL03293:Scaper	APN	9	55874823	missense	probably benign
IGL03340:Scaper	APN	9	55602832	missense	possibly damaging	0.88
IGL03368:Scaper	APN	9	55656027	missense	possibly damaging	0.53
R0111:Scaper	UTSW	9	55602790	missense	probably benign	0.01
R0510:Scaper	UTSW	9	55758062	splice site	probably benign
R0531:Scaper	UTSW	9	55609874	missense	possibly damaging	0.91
R0558:Scaper	UTSW	9	55685923	missense	probably benign	0.08
R0646:Scaper	UTSW	9	55758056	missense	probably damaging	1.00
R0837:Scaper	UTSW	9	55859042	nonsense	probably null
R1440:Scaper	UTSW	9	55602918	nonsense	probably null
R1548:Scaper	UTSW	9	55816670	missense	probably damaging	1.00
R1777:Scaper	UTSW	9	55864546	missense	probably benign	0.33
R1822:Scaper	UTSW	9	55859900	missense	probably damaging	0.99
R1834:Scaper	UTSW	9	55816734	missense	possibly damaging	0.90
R1870:Scaper	UTSW	9	55685938	missense	probably damaging	1.00
R2102:Scaper	UTSW	9	55912050	missense	probably benign	0.43
R2168:Scaper	UTSW	9	55743639	missense	probably damaging	1.00
R2174:Scaper	UTSW	9	55859037	missense	probably null	0.01
R3690:Scaper	UTSW	9	55883921	missense	probably benign	0.00
R4392:Scaper	UTSW	9	55858115	missense	probably damaging	0.99
R4418:Scaper	UTSW	9	55838180	missense	probably damaging	1.00
R4606:Scaper	UTSW	9	55655903	critical splice donor site	probably null
R4643:Scaper	UTSW	9	55838179	missense	probably damaging	0.99
R4665:Scaper	UTSW	9	55912055	missense	probably damaging	1.00
R4739:Scaper	UTSW	9	55743648	missense	probably damaging	1.00
R4921:Scaper	UTSW	9	55892235	missense	probably benign	0.02
R4934:Scaper	UTSW	9	55809175	missense	probably damaging	1.00
R4956:Scaper	UTSW	9	55838142	missense	probably damaging	1.00
R5055:Scaper	UTSW	9	55859719	splice site	probably null
R5107:Scaper	UTSW	9	55580332	missense	probably damaging	1.00
R5155:Scaper	UTSW	9	55556086	missense	probably null	1.00
R5265:Scaper	UTSW	9	55864546	missense	probably benign
R5408:Scaper	UTSW	9	55586224	missense	probably damaging	0.99
R5623:Scaper	UTSW	9	55864507	missense	probably benign	0.02
R5665:Scaper	UTSW	9	55807632	missense	probably damaging	1.00
R5748:Scaper	UTSW	9	55859076	critical splice acceptor site	probably null
R5771:Scaper	UTSW	9	55816791	missense	probably damaging	1.00
R6534:Scaper	UTSW	9	55883976	missense	probably benign	0.00
R6557:Scaper	UTSW	9	55550850	missense	probably benign	0.02
R6651:Scaper	UTSW	9	55858504	missense	probably benign	0.05
R6796:Scaper	UTSW	9	55864427	missense	probably benign	0.00
R6962:Scaper	UTSW	9	55859771	missense	probably benign	0.01
R7145:Scaper	UTSW	9	55912111	missense	unknown
R7199:Scaper	UTSW	9	55838176	nonsense	probably null
R7356:Scaper	UTSW	9	55892211	missense	unknown
R7426:Scaper	UTSW	9	55762277	nonsense	probably null
R7503:Scaper	UTSW	9	55807754	missense	probably damaging	0.98
R7844:Scaper	UTSW	9	55815448	missense	probably benign	0.04
R7966:Scaper	UTSW	9	55762327	missense	probably damaging	0.98
R7992:Scaper	UTSW	9	55858154	missense	probably benign	0.02
R8081:Scaper	UTSW	9	55916046	missense	unknown
R8189:Scaper	UTSW	9	55912120	missense	probably damaging	1.00
R8294:Scaper	UTSW	9	55609996	missense	possibly damaging	0.62
R8351:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8451:Scaper	UTSW	9	55816804	missense	possibly damaging	0.92
R8473:Scaper	UTSW	9	55550847	missense	probably damaging	1.00
R8476:Scaper	UTSW	9	55762291	missense	probably damaging	1.00
R8504:Scaper	UTSW	9	55864438	missense	probably benign
R9058:Scaper	UTSW	9	55815478	missense	probably damaging	1.00
R9071:Scaper	UTSW	9	55864519	missense	probably benign
R9099:Scaper	UTSW	9	55762332	missense	probably damaging	0.98
R9104:Scaper	UTSW	9	55912116	missense	unknown
R9516:Scaper	UTSW	9	55685991	missense	probably benign	0.05
R9685:Scaper	UTSW	9	55864551	missense	probably benign	0.10
X0012:Scaper	UTSW	9	55655930	missense	probably damaging	0.98
X0052:Scaper	UTSW	9	55816664	missense	probably damaging	1.00
Z1176:Scaper	UTSW	9	55556248	missense	probably damaging	1.00

Predicted Primers

Posted On

2013-07-11