Incidental Mutation 'PIT4677001:Galntl6'
ID556556
Institutional Source Beutler Lab
Gene Symbol Galntl6
Ensembl Gene ENSMUSG00000096914
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #PIT4677001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location57774052-58912640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57857587 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 360 (C360Y)
Ref Sequence ENSEMBL: ENSMUSP00000145321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204128]
Predicted Effect
SMART Domains Protein: ENSMUSP00000096353
Gene: ENSMUSG00000096914
AA Change: C175Y

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 1 144 1.6e-18 PFAM
Pfam:Glyco_transf_7C 113 187 3.6e-12 PFAM
RICIN 268 401 7.9e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204128
AA Change: C360Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145321
Gene: ENSMUSG00000096914
AA Change: C360Y

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 140 404 2.1e-9 PFAM
Pfam:Glycos_transf_2 143 328 7.3e-33 PFAM
Pfam:Glyco_tranf_2_2 143 356 1.2e-8 PFAM
Pfam:Glyco_transf_7C 297 371 6.2e-12 PFAM
RICIN 452 585 7.9e-21 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 71.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T A 2: 127,187,013 T89S probably benign Het
4921517D22Rik A T 13: 59,690,491 F176I probably benign Het
Acsm3 A G 7: 119,775,117 D264G probably damaging Het
Adamts12 T A 15: 11,286,810 F834I probably benign Het
Arhgap45 A T 10: 80,020,749 M171L probably benign Het
Arid5b A T 10: 68,098,011 M687K probably damaging Het
AU040320 A T 4: 126,792,237 Q202L probably benign Het
Ccdc47 A G 11: 106,208,208 L219P probably damaging Het
Cfhr2 T G 1: 139,805,379 S301R unknown Het
Cog2 T A 8: 124,545,271 V508E probably benign Het
Cpb2 A G 14: 75,256,023 T47A probably benign Het
Ddx60 A T 8: 61,972,254 K692I possibly damaging Het
Defb34 A T 8: 19,126,396 R34S possibly damaging Het
Fads2 A T 19: 10,070,330 I275N probably damaging Het
Fam196b A T 11: 34,403,122 N388I probably benign Het
Fmn2 T G 1: 174,647,133 S1221A probably damaging Het
Fndc3a A T 14: 72,574,595 V302E probably benign Het
Gm14025 T C 2: 129,038,716 D430G Het
Gm16519 A T 17: 70,929,511 I152F probably benign Het
Hnrnpr T A 4: 136,329,439 V250D probably damaging Het
Hs3st6 A G 17: 24,758,311 D255G possibly damaging Het
Ino80 C T 2: 119,377,545 V1422M probably benign Het
Kcnu1 A G 8: 25,905,993 I669V probably benign Het
Layn A T 9: 51,057,411 V344E probably damaging Het
Mgll A T 6: 88,825,681 R273W possibly damaging Het
Myh2 G A 11: 67,181,992 S636N probably benign Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Pkd1 T G 17: 24,574,029 S1563R possibly damaging Het
Ppp4r3b G A 11: 29,187,978 V109I probably benign Het
Prdm2 A T 4: 143,135,078 D547E probably damaging Het
Prss46 A T 9: 110,856,030 M241L probably benign Het
Ptprf T A 4: 118,213,612 I1397F probably damaging Het
Pus10 A T 11: 23,720,171 T418S possibly damaging Het
Qsox2 T C 2: 26,222,308 D74G probably damaging Het
Sctr T C 1: 120,061,904 V383A probably damaging Het
Siglec1 T A 2: 131,072,757 N1480Y probably damaging Het
Skint2 T C 4: 112,625,938 I180T probably benign Het
Snd1 A G 6: 28,880,296 I690V probably benign Het
Spire1 T C 18: 67,491,365 T575A probably damaging Het
Srbd1 G A 17: 86,115,212 R459* probably null Het
Tll2 C A 19: 41,130,558 V244L probably benign Het
Tmem60 A G 5: 20,886,368 I44V probably benign Het
Ttc30a1 A G 2: 75,979,769 Y657H possibly damaging Het
Utrn T A 10: 12,666,704 I1846F probably benign Het
Vps8 T C 16: 21,500,334 F641S possibly damaging Het
Other mutations in Galntl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Galntl6 APN 8 57857540 missense probably damaging 1.00
IGL00557:Galntl6 APN 8 58911417 missense possibly damaging 0.71
IGL01140:Galntl6 APN 8 57958322 missense probably damaging 1.00
IGL01412:Galntl6 APN 8 57777294 missense probably damaging 0.99
IGL01458:Galntl6 APN 8 58427709 missense probably damaging 1.00
IGL01575:Galntl6 APN 8 58427676 intron probably benign
IGL01700:Galntl6 APN 8 57958460 splice site probably benign
IGL01710:Galntl6 APN 8 58535968 missense probably damaging 0.97
IGL02611:Galntl6 APN 8 57958416 missense probably damaging 1.00
IGL02880:Galntl6 APN 8 57804272 missense probably benign 0.44
IGL03129:Galntl6 APN 8 58427716 missense probably damaging 1.00
IGL03215:Galntl6 APN 8 58911402 missense probably benign 0.00
IGL03249:Galntl6 APN 8 57777176 utr 3 prime probably benign
Fragilistic UTSW 8 58535984 missense probably benign
Indubitably UTSW 8 58427770 missense probably damaging 1.00
R0600:Galntl6 UTSW 8 57837183 splice site probably null
R0731:Galntl6 UTSW 8 58535984 missense probably benign
R0961:Galntl6 UTSW 8 58911340 missense probably benign
R1381:Galntl6 UTSW 8 58472955 missense probably damaging 0.99
R2137:Galntl6 UTSW 8 58535905 critical splice donor site probably null
R4632:Galntl6 UTSW 8 58427823 missense probably damaging 1.00
R4731:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4732:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4733:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4920:Galntl6 UTSW 8 58427773 missense probably damaging 0.97
R4964:Galntl6 UTSW 8 58699911 intron probably benign
R5357:Galntl6 UTSW 8 57884463 missense probably damaging 0.99
R5526:Galntl6 UTSW 8 58472970 missense probably benign
R5951:Galntl6 UTSW 8 57962402 missense probably benign 0.06
R5965:Galntl6 UTSW 8 57857531 missense probably benign 0.03
R6260:Galntl6 UTSW 8 57884481 missense probably damaging 1.00
R6368:Galntl6 UTSW 8 58911441 missense probably damaging 1.00
R6695:Galntl6 UTSW 8 58427770 missense probably damaging 1.00
R7593:Galntl6 UTSW 8 57777259 missense probably damaging 1.00
R7780:Galntl6 UTSW 8 58427699 critical splice donor site probably null
R7833:Galntl6 UTSW 8 57857537 missense probably benign
R7871:Galntl6 UTSW 8 57837188 missense probably damaging 0.98
R8097:Galntl6 UTSW 8 57962373 splice site probably null
Z1176:Galntl6 UTSW 8 57857558 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCAGACAGTGTCTTAGCTT -3'
(R):5'- TGTTGACTTCACTGTTTGGAAAATT -3'

Sequencing Primer
(F):5'- AGACAGTGTCTTAGCTTATCCCATG -3'
(R):5'- TGGAACATGATCATCTGGCC -3'
Posted On2019-06-07