Incidental Mutation 'R0605:Peak1'
ID 55656
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Name pseudopodium-enriched atypical kinase 1
Synonyms 1110049L02Rik, C230081A13Rik, NKF3 kinase family member
MMRRC Submission 038794-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.403) question?
Stock # R0605 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 56108410-56325351 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 56134382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000188142]
AlphaFold Q69Z38
Predicted Effect probably benign
Transcript: ENSMUST00000061552
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102326
Predicted Effect probably benign
Transcript: ENSMUST00000188142
SMART Domains Protein: ENSMUSP00000139985
Gene: ENSMUSG00000074305

DomainStartEndE-ValueType
STYKc 288 622 5.5e-4 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.4%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik G A 10: 20,186,973 (GRCm39) probably benign Het
Adam28 A T 14: 68,844,049 (GRCm39) probably benign Het
Adamts3 A G 5: 90,009,334 (GRCm39) W110R possibly damaging Het
Add1 T C 5: 34,771,568 (GRCm39) V342A possibly damaging Het
Aff3 A G 1: 38,249,068 (GRCm39) S680P probably damaging Het
Ak9 T C 10: 41,221,135 (GRCm39) Y322H probably damaging Het
Als2 A G 1: 59,207,573 (GRCm39) L1528S probably benign Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
Atp6v1a A C 16: 43,931,859 (GRCm39) probably null Het
Bpi T C 2: 158,103,314 (GRCm39) L103P probably damaging Het
Cd80 G A 16: 38,303,056 (GRCm39) V168I probably benign Het
Cfh T C 1: 140,030,096 (GRCm39) S926G probably damaging Het
Chrd A T 16: 20,554,189 (GRCm39) T304S probably damaging Het
Chsy3 A G 18: 59,542,125 (GRCm39) Y421C probably damaging Het
Cmbl T G 15: 31,585,455 (GRCm39) V101G probably damaging Het
Colgalt2 T A 1: 152,371,543 (GRCm39) probably benign Het
Coq4 C T 2: 29,680,010 (GRCm39) Q101* probably null Het
Cr2 T C 1: 194,845,904 (GRCm39) probably benign Het
Cry1 T C 10: 85,020,223 (GRCm39) D38G probably damaging Het
Dmxl2 T C 9: 54,327,229 (GRCm39) D758G probably benign Het
Epsti1 C T 14: 78,164,677 (GRCm39) probably benign Het
Fam24b T C 7: 130,928,915 (GRCm39) probably benign Het
Fem1c G A 18: 46,638,227 (GRCm39) R592C probably benign Het
Foxred1 T C 9: 35,116,178 (GRCm39) Y490C possibly damaging Het
Gm9875 A G 2: 13,562,699 (GRCm39) K9R unknown Het
Grid2ip T C 5: 143,365,117 (GRCm39) S322P probably damaging Het
Gucy1b2 A G 14: 62,640,608 (GRCm39) probably benign Het
Hmcn1 A T 1: 150,533,127 (GRCm39) probably null Het
Hpdl C T 4: 116,677,984 (GRCm39) S159N possibly damaging Het
Hsd17b12 A T 2: 93,863,987 (GRCm39) M285K probably benign Het
Icam5 T C 9: 20,943,493 (GRCm39) I23T probably benign Het
Kat5 A G 19: 5,658,364 (GRCm39) probably benign Het
Lama3 A G 18: 12,640,006 (GRCm39) N67S probably benign Het
Lamb2 T C 9: 108,363,304 (GRCm39) probably benign Het
Lgals3bp A G 11: 118,284,220 (GRCm39) F453S probably damaging Het
Lypd4 A G 7: 24,564,800 (GRCm39) Y113H probably damaging Het
Mdm1 C T 10: 117,982,506 (GRCm39) T47M probably damaging Het
Mei1 C A 15: 81,954,351 (GRCm39) T52K probably benign Het
Meiob G A 17: 25,037,236 (GRCm39) probably benign Het
Ndufaf6 A G 4: 11,051,224 (GRCm39) V292A probably damaging Het
Neb T A 2: 52,154,038 (GRCm39) M2358L possibly damaging Het
Nlrp1b A G 11: 71,047,005 (GRCm39) S1119P possibly damaging Het
Nsmaf A G 4: 6,418,470 (GRCm39) probably null Het
Ogfod1 T C 8: 94,773,895 (GRCm39) probably benign Het
Or5ae2 T C 7: 84,506,345 (GRCm39) I256T probably damaging Het
Or8h7 T C 2: 86,720,763 (GRCm39) Y252C possibly damaging Het
Or9s14 G T 1: 92,535,618 (GRCm39) V20L probably benign Het
Osbpl1a T A 18: 13,015,336 (GRCm39) probably null Het
Otud7b T A 3: 96,052,270 (GRCm39) probably benign Het
P3h3 T A 6: 124,832,998 (GRCm39) H185L probably damaging Het
P4htm G A 9: 108,460,923 (GRCm39) A183V probably null Het
Phf20l1 A G 15: 66,466,971 (GRCm39) K88R probably damaging Het
Phlpp2 A G 8: 110,659,843 (GRCm39) N721S probably benign Het
Plagl2 T C 2: 153,077,864 (GRCm39) K39R probably benign Het
Plppr1 A T 4: 49,323,466 (GRCm39) N252I probably damaging Het
Pom121l2 C T 13: 22,166,206 (GRCm39) A159V probably damaging Het
Prom2 C A 2: 127,381,915 (GRCm39) probably null Het
Prrc2c T C 1: 162,509,995 (GRCm39) T1017A probably damaging Het
Rimbp3 G T 16: 17,029,563 (GRCm39) A996S probably damaging Het
Rnf213 A G 11: 119,322,543 (GRCm39) T1387A probably benign Het
Scaper A T 9: 55,722,802 (GRCm39) probably benign Het
Scara5 A G 14: 65,997,097 (GRCm39) E403G possibly damaging Het
Scrib T C 15: 75,939,402 (GRCm39) I94V possibly damaging Het
Shank3 T C 15: 89,408,350 (GRCm39) F67L possibly damaging Het
Shprh T C 10: 11,082,856 (GRCm39) F1562L probably damaging Het
Src C T 2: 157,311,841 (GRCm39) T529M probably damaging Het
Sycp2l T A 13: 41,296,942 (GRCm39) M341K probably benign Het
Syde1 T C 10: 78,424,929 (GRCm39) probably benign Het
Tars3 A T 7: 65,327,819 (GRCm39) R509S probably damaging Het
Tle6 T A 10: 81,430,180 (GRCm39) H324L probably damaging Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,179,912 (GRCm39) probably benign Het
Tnfrsf14 T A 4: 155,009,837 (GRCm39) K115* probably null Het
Trappc10 T C 10: 78,037,331 (GRCm39) N824S possibly damaging Het
Tsc1 C T 2: 28,561,790 (GRCm39) S309F probably damaging Het
Ttc21a A G 9: 119,790,908 (GRCm39) I885V possibly damaging Het
Ttn C T 2: 76,570,797 (GRCm39) A26699T probably damaging Het
Ttn T C 2: 76,778,715 (GRCm39) Y1262C unknown Het
Usp49 T C 17: 47,985,851 (GRCm39) probably null Het
Vmn1r226 A T 17: 20,908,133 (GRCm39) T122S probably benign Het
Vps8 A T 16: 21,378,087 (GRCm39) T1033S probably benign Het
Vwf C A 6: 125,662,800 (GRCm39) T2728K probably benign Het
Wdr5b T C 16: 35,862,366 (GRCm39) S162P probably benign Het
Xrn1 C T 9: 95,908,930 (GRCm39) Q1235* probably null Het
Zfp1005 A G 2: 150,110,523 (GRCm39) I404M unknown Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56,134,610 (GRCm39) missense probably damaging 1.00
IGL00544:Peak1 APN 9 56,167,262 (GRCm39) missense probably damaging 1.00
IGL01141:Peak1 APN 9 56,165,811 (GRCm39) missense probably benign 0.01
IGL01743:Peak1 APN 9 56,166,486 (GRCm39) missense probably damaging 1.00
IGL01781:Peak1 APN 9 56,167,349 (GRCm39) missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56,167,388 (GRCm39) missense probably damaging 1.00
IGL01941:Peak1 APN 9 56,166,059 (GRCm39) missense probably damaging 1.00
IGL02455:Peak1 APN 9 56,134,757 (GRCm39) missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56,134,490 (GRCm39) missense probably damaging 1.00
IGL03247:Peak1 APN 9 56,165,214 (GRCm39) missense probably damaging 1.00
IGL03259:Peak1 APN 9 56,167,251 (GRCm39) missense probably damaging 1.00
R0060:Peak1 UTSW 9 56,135,107 (GRCm39) missense probably damaging 1.00
R0087:Peak1 UTSW 9 56,165,609 (GRCm39) missense probably damaging 1.00
R0480:Peak1 UTSW 9 56,165,916 (GRCm39) missense probably benign 0.00
R0569:Peak1 UTSW 9 56,167,373 (GRCm39) missense probably damaging 1.00
R0865:Peak1 UTSW 9 56,165,116 (GRCm39) missense probably benign 0.02
R1117:Peak1 UTSW 9 56,165,702 (GRCm39) missense probably benign 0.05
R1922:Peak1 UTSW 9 56,113,971 (GRCm39) missense probably damaging 1.00
R1959:Peak1 UTSW 9 56,114,073 (GRCm39) missense probably damaging 1.00
R2069:Peak1 UTSW 9 56,166,043 (GRCm39) missense probably damaging 1.00
R2083:Peak1 UTSW 9 56,166,233 (GRCm39) missense probably damaging 1.00
R2154:Peak1 UTSW 9 56,114,496 (GRCm39) missense probably damaging 1.00
R2407:Peak1 UTSW 9 56,166,510 (GRCm39) missense probably damaging 1.00
R3832:Peak1 UTSW 9 56,165,667 (GRCm39) missense probably benign
R3938:Peak1 UTSW 9 56,167,649 (GRCm39) missense probably benign 0.01
R3964:Peak1 UTSW 9 56,167,263 (GRCm39) missense probably damaging 1.00
R4192:Peak1 UTSW 9 56,166,025 (GRCm39) missense probably damaging 1.00
R4381:Peak1 UTSW 9 56,165,711 (GRCm39) missense probably benign 0.34
R4869:Peak1 UTSW 9 56,134,876 (GRCm39) missense probably benign 0.06
R4994:Peak1 UTSW 9 56,148,560 (GRCm39) missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56,167,573 (GRCm39) missense probably damaging 1.00
R5435:Peak1 UTSW 9 56,113,770 (GRCm39) missense probably damaging 0.98
R5632:Peak1 UTSW 9 56,165,058 (GRCm39) missense probably damaging 1.00
R5643:Peak1 UTSW 9 56,166,039 (GRCm39) missense probably damaging 0.99
R5880:Peak1 UTSW 9 56,114,894 (GRCm39) missense probably damaging 1.00
R5898:Peak1 UTSW 9 56,114,622 (GRCm39) missense probably benign 0.19
R5986:Peak1 UTSW 9 56,166,726 (GRCm39) missense probably benign 0.00
R6109:Peak1 UTSW 9 56,166,567 (GRCm39) missense probably benign 0.01
R6284:Peak1 UTSW 9 56,167,580 (GRCm39) missense probably benign 0.10
R6347:Peak1 UTSW 9 56,165,495 (GRCm39) missense probably benign 0.00
R6374:Peak1 UTSW 9 56,164,950 (GRCm39) missense probably damaging 1.00
R6471:Peak1 UTSW 9 56,165,543 (GRCm39) missense probably damaging 1.00
R6717:Peak1 UTSW 9 56,114,523 (GRCm39) missense probably benign 0.00
R7033:Peak1 UTSW 9 56,166,991 (GRCm39) missense probably damaging 1.00
R7039:Peak1 UTSW 9 56,165,093 (GRCm39) missense probably benign 0.01
R7100:Peak1 UTSW 9 56,166,677 (GRCm39) missense probably damaging 1.00
R7604:Peak1 UTSW 9 56,148,491 (GRCm39) nonsense probably null
R7868:Peak1 UTSW 9 56,167,754 (GRCm39) missense probably damaging 1.00
R7979:Peak1 UTSW 9 56,114,676 (GRCm39) missense possibly damaging 0.52
R8258:Peak1 UTSW 9 56,166,677 (GRCm39) missense probably damaging 1.00
R8259:Peak1 UTSW 9 56,166,677 (GRCm39) missense probably damaging 1.00
R8272:Peak1 UTSW 9 56,166,182 (GRCm39) missense probably damaging 1.00
R8324:Peak1 UTSW 9 56,114,760 (GRCm39) missense probably damaging 1.00
R8516:Peak1 UTSW 9 56,167,284 (GRCm39) missense probably damaging 1.00
R8847:Peak1 UTSW 9 56,114,427 (GRCm39) missense probably damaging 1.00
R8895:Peak1 UTSW 9 56,113,938 (GRCm39) missense probably benign
R9082:Peak1 UTSW 9 56,165,504 (GRCm39) missense probably benign 0.07
R9138:Peak1 UTSW 9 56,164,925 (GRCm39) missense probably benign 0.34
R9355:Peak1 UTSW 9 56,167,454 (GRCm39) missense probably damaging 1.00
R9548:Peak1 UTSW 9 56,113,917 (GRCm39) missense probably benign 0.19
R9591:Peak1 UTSW 9 56,166,834 (GRCm39) missense possibly damaging 0.48
R9642:Peak1 UTSW 9 56,167,205 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGGAGGCTCACTCCCTTTCACAC -3'
(R):5'- AGCCACAGAGACAAGCACTTTATCG -3'

Sequencing Primer
(F):5'- TCCCTTTCACACAATGGAAGAG -3'
(R):5'- GAAGCCTTCATACAGATGCCTTG -3'
Posted On 2013-07-11