Incidental Mutation 'PIT4677001:Fam196b'
ID556566
Institutional Source Beutler Lab
Gene Symbol Fam196b
Ensembl Gene ENSMUSG00000069911
Gene Namefamily with sequence similarity 196, member B
SynonymsGm6041
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #PIT4677001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location34314822-34422640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34403122 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 388 (N388I)
Ref Sequence ENSEMBL: ENSMUSP00000090883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101364] [ENSMUST00000101365] [ENSMUST00000165963]
Predicted Effect probably benign
Transcript: ENSMUST00000093192
AA Change: N388I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911
AA Change: N388I

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101364
Predicted Effect probably benign
Transcript: ENSMUST00000101365
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165963
AA Change: N388I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911
AA Change: N388I

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 71.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T A 2: 127,187,013 T89S probably benign Het
4921517D22Rik A T 13: 59,690,491 F176I probably benign Het
Acsm3 A G 7: 119,775,117 D264G probably damaging Het
Adamts12 T A 15: 11,286,810 F834I probably benign Het
Arhgap45 A T 10: 80,020,749 M171L probably benign Het
Arid5b A T 10: 68,098,011 M687K probably damaging Het
AU040320 A T 4: 126,792,237 Q202L probably benign Het
Ccdc47 A G 11: 106,208,208 L219P probably damaging Het
Cfhr2 T G 1: 139,805,379 S301R unknown Het
Cog2 T A 8: 124,545,271 V508E probably benign Het
Cpb2 A G 14: 75,256,023 T47A probably benign Het
Ddx60 A T 8: 61,972,254 K692I possibly damaging Het
Defb34 A T 8: 19,126,396 R34S possibly damaging Het
Fads2 A T 19: 10,070,330 I275N probably damaging Het
Fmn2 T G 1: 174,647,133 S1221A probably damaging Het
Fndc3a A T 14: 72,574,595 V302E probably benign Het
Galntl6 C T 8: 57,857,587 C360Y probably damaging Het
Gm14025 T C 2: 129,038,716 D430G Het
Gm16519 A T 17: 70,929,511 I152F probably benign Het
Hnrnpr T A 4: 136,329,439 V250D probably damaging Het
Hs3st6 A G 17: 24,758,311 D255G possibly damaging Het
Ino80 C T 2: 119,377,545 V1422M probably benign Het
Kcnu1 A G 8: 25,905,993 I669V probably benign Het
Layn A T 9: 51,057,411 V344E probably damaging Het
Mgll A T 6: 88,825,681 R273W possibly damaging Het
Myh2 G A 11: 67,181,992 S636N probably benign Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Pkd1 T G 17: 24,574,029 S1563R possibly damaging Het
Ppp4r3b G A 11: 29,187,978 V109I probably benign Het
Prdm2 A T 4: 143,135,078 D547E probably damaging Het
Prss46 A T 9: 110,856,030 M241L probably benign Het
Ptprf T A 4: 118,213,612 I1397F probably damaging Het
Pus10 A T 11: 23,720,171 T418S possibly damaging Het
Qsox2 T C 2: 26,222,308 D74G probably damaging Het
Sctr T C 1: 120,061,904 V383A probably damaging Het
Siglec1 T A 2: 131,072,757 N1480Y probably damaging Het
Skint2 T C 4: 112,625,938 I180T probably benign Het
Snd1 A G 6: 28,880,296 I690V probably benign Het
Spire1 T C 18: 67,491,365 T575A probably damaging Het
Srbd1 G A 17: 86,115,212 R459* probably null Het
Tll2 C A 19: 41,130,558 V244L probably benign Het
Tmem60 A G 5: 20,886,368 I44V probably benign Het
Ttc30a1 A G 2: 75,979,769 Y657H possibly damaging Het
Utrn T A 10: 12,666,704 I1846F probably benign Het
Vps8 T C 16: 21,500,334 F641S possibly damaging Het
Other mutations in Fam196b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Fam196b APN 11 34403011 missense probably benign
IGL01867:Fam196b APN 11 34403065 missense probably benign 0.39
R0317:Fam196b UTSW 11 34402826 missense possibly damaging 0.94
R1165:Fam196b UTSW 11 34402740 missense probably benign
R1710:Fam196b UTSW 11 34404263 splice site probably null
R2083:Fam196b UTSW 11 34402141 missense probably benign 0.01
R2096:Fam196b UTSW 11 34402936 missense probably benign 0.03
R3820:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3821:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3822:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3969:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3970:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3980:Fam196b UTSW 11 34402678 missense probably benign 0.00
R4092:Fam196b UTSW 11 34401935 start gained probably benign
R4231:Fam196b UTSW 11 34403143 missense probably benign 0.01
R4678:Fam196b UTSW 11 34403227 missense probably damaging 1.00
R4859:Fam196b UTSW 11 34403154 missense probably benign 0.31
R4938:Fam196b UTSW 11 34402231 missense probably damaging 0.98
R5269:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5287:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5358:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5359:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5361:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5362:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5363:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5403:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5705:Fam196b UTSW 11 34404349 missense probably damaging 1.00
R6282:Fam196b UTSW 11 34402819 missense possibly damaging 0.77
R7030:Fam196b UTSW 11 34402030 missense probably damaging 0.96
R7069:Fam196b UTSW 11 34402677 missense possibly damaging 0.48
R7178:Fam196b UTSW 11 34402359 missense probably damaging 0.96
R7180:Fam196b UTSW 11 34419873 missense probably damaging 1.00
R7718:Fam196b UTSW 11 34402539 missense probably benign 0.00
R7789:Fam196b UTSW 11 34402537 missense probably benign
R7832:Fam196b UTSW 11 34403034 missense probably benign
R8377:Fam196b UTSW 11 34401964 missense probably damaging 1.00
Z1177:Fam196b UTSW 11 34402725 missense probably benign 0.01
Z1177:Fam196b UTSW 11 34403188 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTTCTGATTGCCCAGCC -3'
(R):5'- AAACAACTCGGCTCAGTGG -3'

Sequencing Primer
(F):5'- TCTGATTGCCCAGCCTCAGG -3'
(R):5'- CTTACCCTTCAGTGAGAGCGTGAG -3'
Posted On2019-06-07