Incidental Mutation 'PIT4677001:Ccdc47'
ID556569
Institutional Source Beutler Lab
Gene Symbol Ccdc47
Ensembl Gene ENSMUSG00000078622
Gene Namecoiled-coil domain containing 47
Synonymscalumin, asp4, 2610204L23Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4677001 (G1)
Quality Score139.008
Status Not validated
Chromosome11
Chromosomal Location106197408-106216344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106208208 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 219 (L219P)
Ref Sequence ENSEMBL: ENSMUSP00000002043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002043] [ENSMUST00000106865]
Predicted Effect probably damaging
Transcript: ENSMUST00000002043
AA Change: L219P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002043
Gene: ENSMUSG00000078622
AA Change: L219P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 38 N/A INTRINSIC
Pfam:DUF1682 134 467 2.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106865
SMART Domains Protein: ENSMUSP00000102478
Gene: ENSMUSG00000078622

DomainStartEndE-ValueType
Pfam:DUF1682 1 158 9.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125383
SMART Domains Protein: ENSMUSP00000122736
Gene: ENSMUSG00000078622

DomainStartEndE-ValueType
Pfam:DUF1682 1 212 1.3e-53 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: More than half of homozygous null mice die at early embryonic stages while the rest die shortly after birth. Mouse embryonic fibroblasts display insufficient Ca2+ contents in intracellular stores, impaired store-operated Ca2+ entry, and enhanced endoplasmic reticulum stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T A 2: 127,187,013 T89S probably benign Het
4921517D22Rik A T 13: 59,690,491 F176I probably benign Het
Acsm3 A G 7: 119,775,117 D264G probably damaging Het
Adamts12 T A 15: 11,286,810 F834I probably benign Het
Arhgap45 A T 10: 80,020,749 M171L probably benign Het
Arid5b A T 10: 68,098,011 M687K probably damaging Het
AU040320 A T 4: 126,792,237 Q202L probably benign Het
Cfhr2 T G 1: 139,805,379 S301R unknown Het
Cog2 T A 8: 124,545,271 V508E probably benign Het
Cpb2 A G 14: 75,256,023 T47A probably benign Het
Ddx60 A T 8: 61,972,254 K692I possibly damaging Het
Defb34 A T 8: 19,126,396 R34S possibly damaging Het
Fads2 A T 19: 10,070,330 I275N probably damaging Het
Fam196b A T 11: 34,403,122 N388I probably benign Het
Fmn2 T G 1: 174,647,133 S1221A probably damaging Het
Fndc3a A T 14: 72,574,595 V302E probably benign Het
Galntl6 C T 8: 57,857,587 C360Y probably damaging Het
Gm14025 T C 2: 129,038,716 D430G Het
Gm16519 A T 17: 70,929,511 I152F probably benign Het
Hnrnpr T A 4: 136,329,439 V250D probably damaging Het
Hs3st6 A G 17: 24,758,311 D255G possibly damaging Het
Ino80 C T 2: 119,377,545 V1422M probably benign Het
Kcnu1 A G 8: 25,905,993 I669V probably benign Het
Layn A T 9: 51,057,411 V344E probably damaging Het
Mgll A T 6: 88,825,681 R273W possibly damaging Het
Myh2 G A 11: 67,181,992 S636N probably benign Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Pkd1 T G 17: 24,574,029 S1563R possibly damaging Het
Ppp4r3b G A 11: 29,187,978 V109I probably benign Het
Prdm2 A T 4: 143,135,078 D547E probably damaging Het
Prss46 A T 9: 110,856,030 M241L probably benign Het
Ptprf T A 4: 118,213,612 I1397F probably damaging Het
Pus10 A T 11: 23,720,171 T418S possibly damaging Het
Qsox2 T C 2: 26,222,308 D74G probably damaging Het
Sctr T C 1: 120,061,904 V383A probably damaging Het
Siglec1 T A 2: 131,072,757 N1480Y probably damaging Het
Skint2 T C 4: 112,625,938 I180T probably benign Het
Snd1 A G 6: 28,880,296 I690V probably benign Het
Spire1 T C 18: 67,491,365 T575A probably damaging Het
Srbd1 G A 17: 86,115,212 R459* probably null Het
Tll2 C A 19: 41,130,558 V244L probably benign Het
Tmem60 A G 5: 20,886,368 I44V probably benign Het
Ttc30a1 A G 2: 75,979,769 Y657H possibly damaging Het
Utrn T A 10: 12,666,704 I1846F probably benign Het
Vps8 T C 16: 21,500,334 F641S possibly damaging Het
Other mutations in Ccdc47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ccdc47 APN 11 106203532 splice site probably null
IGL01890:Ccdc47 APN 11 106205451 missense probably damaging 1.00
IGL02026:Ccdc47 APN 11 106205027 missense probably damaging 0.96
IGL03343:Ccdc47 APN 11 106204962 missense probably damaging 0.99
R1508:Ccdc47 UTSW 11 106202416 missense probably damaging 1.00
R2239:Ccdc47 UTSW 11 106202134 missense possibly damaging 0.93
R3103:Ccdc47 UTSW 11 106202841 missense probably benign 0.00
R3935:Ccdc47 UTSW 11 106201997 unclassified probably benign
R4783:Ccdc47 UTSW 11 106203604 missense probably benign 0.03
R5150:Ccdc47 UTSW 11 106205439 missense possibly damaging 0.92
R5331:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5362:Ccdc47 UTSW 11 106208213 splice site probably null
R5417:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5420:Ccdc47 UTSW 11 106210350 missense probably benign 0.17
R5473:Ccdc47 UTSW 11 106205029 missense probably damaging 0.98
R6297:Ccdc47 UTSW 11 106203601 missense probably damaging 0.99
R6449:Ccdc47 UTSW 11 106204985 missense probably damaging 1.00
R6981:Ccdc47 UTSW 11 106202737 missense probably benign 0.04
R7136:Ccdc47 UTSW 11 106205004 missense probably benign 0.01
R7170:Ccdc47 UTSW 11 106202478 missense probably benign 0.01
R7340:Ccdc47 UTSW 11 106200973 missense possibly damaging 0.68
R7799:Ccdc47 UTSW 11 106210317 missense possibly damaging 0.84
R8335:Ccdc47 UTSW 11 106208258 missense possibly damaging 0.85
R8335:Ccdc47 UTSW 11 106208259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGAATACTTACCACTTGATC -3'
(R):5'- GTGAGATAGCAGAGCGTTGC -3'

Sequencing Primer
(F):5'- ACCACTTGATCACTCACTGG -3'
(R):5'- AGAGCGTTGCTGCCCTAAC -3'
Posted On2019-06-07