Incidental Mutation 'PIT4677001:Adamts12'
ID 556573
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # PIT4677001 (G1)
Quality Score 213.009
Status Not validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11286896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 834 (F834I)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: F834I

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: F834I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T A 2: 127,028,933 (GRCm39) T89S probably benign Het
4921517D22Rik A T 13: 59,838,305 (GRCm39) F176I probably benign Het
Acsm3 A G 7: 119,374,340 (GRCm39) D264G probably damaging Het
Arhgap45 A T 10: 79,856,583 (GRCm39) M171L probably benign Het
Arid5b A T 10: 67,933,841 (GRCm39) M687K probably damaging Het
AU040320 A T 4: 126,686,030 (GRCm39) Q202L probably benign Het
Ccdc47 A G 11: 106,099,034 (GRCm39) L219P probably damaging Het
Cfhr2 T G 1: 139,733,117 (GRCm39) S301R unknown Het
Cog2 T A 8: 125,272,010 (GRCm39) V508E probably benign Het
Cpb2 A G 14: 75,493,463 (GRCm39) T47A probably benign Het
Ddx60 A T 8: 62,425,288 (GRCm39) K692I possibly damaging Het
Defb34 A T 8: 19,176,412 (GRCm39) R34S possibly damaging Het
Fads2 A T 19: 10,047,694 (GRCm39) I275N probably damaging Het
Fmn2 T G 1: 174,474,699 (GRCm39) S1221A probably damaging Het
Fndc3a A T 14: 72,812,035 (GRCm39) V302E probably benign Het
Galntl6 C T 8: 58,310,621 (GRCm39) C360Y probably damaging Het
Gm16519 A T 17: 71,236,506 (GRCm39) I152F probably benign Het
Hnrnpr T A 4: 136,056,750 (GRCm39) V250D probably damaging Het
Hs3st6 A G 17: 24,977,285 (GRCm39) D255G possibly damaging Het
Ift70a1 A G 2: 75,810,113 (GRCm39) Y657H possibly damaging Het
Ino80 C T 2: 119,208,026 (GRCm39) V1422M probably benign Het
Insyn2b A T 11: 34,353,122 (GRCm39) N388I probably benign Het
Kcnu1 A G 8: 26,396,021 (GRCm39) I669V probably benign Het
Layn A T 9: 50,968,711 (GRCm39) V344E probably damaging Het
Mgll A T 6: 88,802,663 (GRCm39) R273W possibly damaging Het
Myh2 G A 11: 67,072,818 (GRCm39) S636N probably benign Het
Nmur2 A T 11: 55,923,835 (GRCm39) S240T probably benign Het
Pkd1 T G 17: 24,793,003 (GRCm39) S1563R possibly damaging Het
Ppp4r3b G A 11: 29,137,978 (GRCm39) V109I probably benign Het
Prdm2 A T 4: 142,861,648 (GRCm39) D547E probably damaging Het
Prss46 A T 9: 110,685,098 (GRCm39) M241L probably benign Het
Ptprf T A 4: 118,070,809 (GRCm39) I1397F probably damaging Het
Pus10 A T 11: 23,670,171 (GRCm39) T418S possibly damaging Het
Qsox2 T C 2: 26,112,320 (GRCm39) D74G probably damaging Het
Sctr T C 1: 119,989,634 (GRCm39) V383A probably damaging Het
Siglec1 T A 2: 130,914,677 (GRCm39) N1480Y probably damaging Het
Skint2 T C 4: 112,483,135 (GRCm39) I180T probably benign Het
Snd1 A G 6: 28,880,295 (GRCm39) I690V probably benign Het
Spire1 T C 18: 67,624,435 (GRCm39) T575A probably damaging Het
Srbd1 G A 17: 86,422,640 (GRCm39) R459* probably null Het
Tll2 C A 19: 41,118,997 (GRCm39) V244L probably benign Het
Tmem60 A G 5: 21,091,366 (GRCm39) I44V probably benign Het
Utrn T A 10: 12,542,448 (GRCm39) I1846F probably benign Het
Vinac1 T C 2: 128,880,636 (GRCm39) D430G Het
Vps8 T C 16: 21,319,084 (GRCm39) F641S possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTATAGCTCTTAAATGTCTGC -3'
(R):5'- TACCCATGTGATGAAAGCAGACC -3'

Sequencing Primer
(F):5'- GCTTTACAATCGATACTCAGGACAG -3'
(R):5'- CCACATAGTCCCTGTTCAAAGG -3'
Posted On 2019-06-07