Incidental Mutation 'PIT4677001:Spire1'
ID556579
Institutional Source Beutler Lab
Gene Symbol Spire1
Ensembl Gene ENSMUSG00000024533
Gene Namespire type actin nucleation factor 1
Synonyms6030430B19Rik, Spir-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #PIT4677001 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location67488209-67610790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67491365 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 575 (T575A)
Ref Sequence ENSEMBL: ENSMUSP00000110702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045105] [ENSMUST00000082243] [ENSMUST00000115050] [ENSMUST00000224799]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045105
AA Change: T620A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049336
Gene: ENSMUSG00000024533
AA Change: T620A

DomainStartEndE-ValueType
Pfam:KIND 1 78 3.3e-27 PFAM
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 289 316 N/A INTRINSIC
low complexity region 339 350 N/A INTRINSIC
SCOP:d1zbdb_ 445 518 1e-7 SMART
low complexity region 596 606 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082243
AA Change: T575A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080871
Gene: ENSMUSG00000024533
AA Change: T575A

DomainStartEndE-ValueType
Blast:KIND 1 73 2e-26 BLAST
PDB:3RBW|D 1 79 3e-28 PDB
PDB:4EFH|B 176 232 9e-6 PDB
low complexity region 302 329 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
SCOP:d1zbdb_ 400 473 2e-7 SMART
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115050
AA Change: T575A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110702
Gene: ENSMUSG00000024533
AA Change: T575A

DomainStartEndE-ValueType
PDB:4EFH|B 106 162 9e-6 PDB
low complexity region 219 246 N/A INTRINSIC
low complexity region 269 280 N/A INTRINSIC
SCOP:d1zbdb_ 317 390 4e-7 SMART
low complexity region 468 478 N/A INTRINSIC
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000224799
AA Change: T492A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 71.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spire proteins, such as SPIRE1, are highly conserved between species. They belong to the family of Wiskott-Aldrich homology region-2 (WH2) proteins, which are involved in actin organization (Kerkhoff et al., 2001 [PubMed 11747823]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal brain anatomy and intact visual and motor functions in both sexes, but show a male-specific increase in contextual and cued fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T A 2: 127,187,013 T89S probably benign Het
4921517D22Rik A T 13: 59,690,491 F176I probably benign Het
Acsm3 A G 7: 119,775,117 D264G probably damaging Het
Adamts12 T A 15: 11,286,810 F834I probably benign Het
Arhgap45 A T 10: 80,020,749 M171L probably benign Het
Arid5b A T 10: 68,098,011 M687K probably damaging Het
AU040320 A T 4: 126,792,237 Q202L probably benign Het
Ccdc47 A G 11: 106,208,208 L219P probably damaging Het
Cfhr2 T G 1: 139,805,379 S301R unknown Het
Cog2 T A 8: 124,545,271 V508E probably benign Het
Cpb2 A G 14: 75,256,023 T47A probably benign Het
Ddx60 A T 8: 61,972,254 K692I possibly damaging Het
Defb34 A T 8: 19,126,396 R34S possibly damaging Het
Fads2 A T 19: 10,070,330 I275N probably damaging Het
Fam196b A T 11: 34,403,122 N388I probably benign Het
Fmn2 T G 1: 174,647,133 S1221A probably damaging Het
Fndc3a A T 14: 72,574,595 V302E probably benign Het
Galntl6 C T 8: 57,857,587 C360Y probably damaging Het
Gm14025 T C 2: 129,038,716 D430G Het
Gm16519 A T 17: 70,929,511 I152F probably benign Het
Hnrnpr T A 4: 136,329,439 V250D probably damaging Het
Hs3st6 A G 17: 24,758,311 D255G possibly damaging Het
Ino80 C T 2: 119,377,545 V1422M probably benign Het
Kcnu1 A G 8: 25,905,993 I669V probably benign Het
Layn A T 9: 51,057,411 V344E probably damaging Het
Mgll A T 6: 88,825,681 R273W possibly damaging Het
Myh2 G A 11: 67,181,992 S636N probably benign Het
Nmur2 A T 11: 56,033,009 S240T probably benign Het
Pkd1 T G 17: 24,574,029 S1563R possibly damaging Het
Ppp4r3b G A 11: 29,187,978 V109I probably benign Het
Prdm2 A T 4: 143,135,078 D547E probably damaging Het
Prss46 A T 9: 110,856,030 M241L probably benign Het
Ptprf T A 4: 118,213,612 I1397F probably damaging Het
Pus10 A T 11: 23,720,171 T418S possibly damaging Het
Qsox2 T C 2: 26,222,308 D74G probably damaging Het
Sctr T C 1: 120,061,904 V383A probably damaging Het
Siglec1 T A 2: 131,072,757 N1480Y probably damaging Het
Skint2 T C 4: 112,625,938 I180T probably benign Het
Snd1 A G 6: 28,880,296 I690V probably benign Het
Srbd1 G A 17: 86,115,212 R459* probably null Het
Tll2 C A 19: 41,130,558 V244L probably benign Het
Tmem60 A G 5: 20,886,368 I44V probably benign Het
Ttc30a1 A G 2: 75,979,769 Y657H possibly damaging Het
Utrn T A 10: 12,666,704 I1846F probably benign Het
Vps8 T C 16: 21,500,334 F641S possibly damaging Het
Other mutations in Spire1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Spire1 APN 18 67529015 missense probably damaging 1.00
IGL01639:Spire1 APN 18 67545668 missense possibly damaging 0.74
IGL02334:Spire1 APN 18 67506655 missense probably benign 0.00
R0457:Spire1 UTSW 18 67552600 missense probably damaging 0.98
R0531:Spire1 UTSW 18 67491305 missense probably damaging 1.00
R0608:Spire1 UTSW 18 67528875 missense probably damaging 0.99
R2098:Spire1 UTSW 18 67503466 missense probably damaging 0.99
R2299:Spire1 UTSW 18 67530423 missense probably damaging 1.00
R3028:Spire1 UTSW 18 67491347 missense probably damaging 1.00
R3815:Spire1 UTSW 18 67506663 missense probably benign 0.05
R4049:Spire1 UTSW 18 67529031 splice site probably null
R4050:Spire1 UTSW 18 67529031 splice site probably null
R4059:Spire1 UTSW 18 67545713 missense probably damaging 0.98
R4109:Spire1 UTSW 18 67497217 missense probably damaging 1.00
R4700:Spire1 UTSW 18 67512865 missense probably benign 0.01
R4941:Spire1 UTSW 18 67519314 missense possibly damaging 0.54
R4995:Spire1 UTSW 18 67552779 splice site probably null
R5363:Spire1 UTSW 18 67506555 missense probably damaging 1.00
R5561:Spire1 UTSW 18 67506646 missense probably damaging 0.96
R5795:Spire1 UTSW 18 67495195 missense probably benign
R5952:Spire1 UTSW 18 67506709 missense probably benign 0.00
R5982:Spire1 UTSW 18 67497316 critical splice acceptor site probably null
R7388:Spire1 UTSW 18 67519880 missense probably damaging 1.00
R7559:Spire1 UTSW 18 67501117 missense probably benign 0.04
R8006:Spire1 UTSW 18 67501181 nonsense probably null
R8111:Spire1 UTSW 18 67519321 missense probably damaging 0.98
R8675:Spire1 UTSW 18 67491308 missense possibly damaging 0.48
T0970:Spire1 UTSW 18 67501063 splice site probably null
Z1088:Spire1 UTSW 18 67495152 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGAACACAGCCTTGAGTCTGTG -3'
(R):5'- TCCACAAAATCCAGGTCTGTG -3'

Sequencing Primer
(F):5'- ACAGCCTTGAGTCTGTGTCTCAG -3'
(R):5'- TCCAGGTCTGTGGACAAGTC -3'
Posted On2019-06-07