Incidental Mutation 'PIT4585001:Clasp1'
ID556582
Institutional Source Beutler Lab
Gene Symbol Clasp1
Ensembl Gene ENSMUSG00000064302
Gene NameCLIP associating protein 1
Synonyms1700030C23Rik, B130045P17Rik, CLASP1, mCLASP1, 5730583A19Rik, CLASP1alpha
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #PIT4585001 (G1)
Quality Score185.009
Status Not validated
Chromosome1
Chromosomal Location118389058-118612678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118462555 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 156 (N156K)
Ref Sequence ENSEMBL: ENSMUSP00000140019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049404] [ENSMUST00000070989] [ENSMUST00000165223] [ENSMUST00000178710] [ENSMUST00000185405] [ENSMUST00000186349] [ENSMUST00000187713] [ENSMUST00000188710] [ENSMUST00000189262] [ENSMUST00000189570] [ENSMUST00000189738] [ENSMUST00000190571] [ENSMUST00000190733] [ENSMUST00000191445]
Predicted Effect probably damaging
Transcript: ENSMUST00000049404
AA Change: N156K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042266
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070989
AA Change: N156K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067858
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 3.23e-1 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165223
AA Change: N156K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128089
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1056 3.23e-1 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178710
AA Change: N156K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137137
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1047 6.55e-2 SMART
low complexity region 1058 1075 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
TOG 1210 1448 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185405
AA Change: N156K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139619
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 769 783 N/A INTRINSIC
low complexity region 801 811 N/A INTRINSIC
TOG 827 1065 1.6e-5 SMART
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1166 1177 N/A INTRINSIC
TOG 1228 1466 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186349
AA Change: N156K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141105
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
TOG 847 1085 3.23e-1 SMART
low complexity region 1096 1113 N/A INTRINSIC
low complexity region 1134 1147 N/A INTRINSIC
low complexity region 1225 1236 N/A INTRINSIC
TOG 1287 1525 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187713
AA Change: N156K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139526
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 768 782 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
TOG 826 1064 1.6e-5 SMART
low complexity region 1075 1092 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
TOG 1227 1465 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188710
AA Change: N156K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140593
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
low complexity region 818 832 N/A INTRINSIC
low complexity region 850 860 N/A INTRINSIC
TOG 876 1114 1.6e-5 SMART
low complexity region 1125 1142 N/A INTRINSIC
low complexity region 1215 1226 N/A INTRINSIC
TOG 1277 1515 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189262
AA Change: N156K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140860
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
TOG 802 1040 1.6e-5 SMART
low complexity region 1051 1068 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
TOG 1203 1441 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189570
AA Change: N156K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140167
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 684 714 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
TOG 818 1055 3.2e-6 SMART
low complexity region 1066 1083 N/A INTRINSIC
low complexity region 1156 1167 N/A INTRINSIC
TOG 1218 1456 2.3e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189738
AA Change: N156K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140665
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 7.31e-51 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 1.14e-11 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 668 698 N/A INTRINSIC
low complexity region 752 766 N/A INTRINSIC
low complexity region 784 794 N/A INTRINSIC
TOG 810 1048 3.23e-1 SMART
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1149 1160 N/A INTRINSIC
TOG 1211 1449 4.96e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190571
AA Change: N156K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140019
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 682 715 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
low complexity region 805 819 N/A INTRINSIC
low complexity region 837 847 N/A INTRINSIC
TOG 863 1101 1.6e-5 SMART
low complexity region 1112 1129 N/A INTRINSIC
low complexity region 1150 1163 N/A INTRINSIC
low complexity region 1241 1252 N/A INTRINSIC
TOG 1303 1541 2.3e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190733
Predicted Effect probably damaging
Transcript: ENSMUST00000191445
AA Change: N156K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140095
Gene: ENSMUSG00000064302
AA Change: N156K

DomainStartEndE-ValueType
TOG 1 232 3.4e-55 SMART
low complexity region 252 266 N/A INTRINSIC
low complexity region 280 296 N/A INTRINSIC
TOG 319 551 5.5e-16 SMART
low complexity region 579 594 N/A INTRINSIC
low complexity region 606 633 N/A INTRINSIC
low complexity region 674 707 N/A INTRINSIC
low complexity region 761 775 N/A INTRINSIC
low complexity region 793 803 N/A INTRINSIC
TOG 819 1056 3.2e-6 SMART
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1157 1168 N/A INTRINSIC
TOG 1219 1457 2.3e-34 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Clasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01785:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01786:Clasp1 APN 1 118497736 missense possibly damaging 0.74
IGL01871:Clasp1 APN 1 118570889 missense probably damaging 1.00
IGL02066:Clasp1 APN 1 118565260 critical splice donor site probably null
IGL02602:Clasp1 APN 1 118471785 missense probably damaging 0.99
IGL02683:Clasp1 APN 1 118539266 missense probably benign 0.33
IGL02728:Clasp1 APN 1 118602377 missense probably damaging 1.00
IGL02820:Clasp1 APN 1 118551104 missense possibly damaging 0.77
IGL02874:Clasp1 APN 1 118552043 missense possibly damaging 0.86
IGL02975:Clasp1 APN 1 118462547 missense probably damaging 1.00
IGL03100:Clasp1 APN 1 118467896 missense possibly damaging 0.79
IGL03115:Clasp1 APN 1 118501323 nonsense probably null
IGL03122:Clasp1 APN 1 118510277 missense probably damaging 1.00
IGL03180:Clasp1 APN 1 118505525 missense probably benign 0.33
IGL03248:Clasp1 APN 1 118602476 missense probably benign 0.01
IGL03388:Clasp1 APN 1 118505503 missense possibly damaging 0.95
F5770:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
I2288:Clasp1 UTSW 1 118565229 missense probably benign 0.09
R0079:Clasp1 UTSW 1 118543304 missense probably damaging 1.00
R0395:Clasp1 UTSW 1 118539331 missense possibly damaging 0.48
R0960:Clasp1 UTSW 1 118552026 missense probably benign 0.39
R1448:Clasp1 UTSW 1 118508916 missense probably benign 0.01
R1497:Clasp1 UTSW 1 118552058 missense probably benign 0.42
R1607:Clasp1 UTSW 1 118504959 missense probably damaging 0.98
R1722:Clasp1 UTSW 1 118590464 missense probably damaging 1.00
R1758:Clasp1 UTSW 1 118548025 missense probably damaging 1.00
R1765:Clasp1 UTSW 1 118505531 missense probably damaging 0.99
R1855:Clasp1 UTSW 1 118508894 missense probably damaging 1.00
R1861:Clasp1 UTSW 1 118570931 missense possibly damaging 0.93
R1874:Clasp1 UTSW 1 118600585 critical splice donor site probably null
R1942:Clasp1 UTSW 1 118501348 missense possibly damaging 0.94
R2025:Clasp1 UTSW 1 118504899 missense probably damaging 1.00
R2174:Clasp1 UTSW 1 118560095 missense probably damaging 1.00
R2280:Clasp1 UTSW 1 118565183 missense probably benign 0.05
R2288:Clasp1 UTSW 1 118578878 missense probably benign
R2895:Clasp1 UTSW 1 118459838 missense probably damaging 1.00
R3958:Clasp1 UTSW 1 118467881 missense probably damaging 0.99
R4073:Clasp1 UTSW 1 118503848 missense probably damaging 1.00
R4206:Clasp1 UTSW 1 118578906 missense probably damaging 1.00
R4465:Clasp1 UTSW 1 118561078 missense probably damaging 1.00
R4609:Clasp1 UTSW 1 118503035 intron probably benign
R4679:Clasp1 UTSW 1 118543271 missense probably damaging 0.99
R4707:Clasp1 UTSW 1 118543197 nonsense probably null
R4809:Clasp1 UTSW 1 118461250 missense probably benign 0.00
R4906:Clasp1 UTSW 1 118508910 nonsense probably null
R5048:Clasp1 UTSW 1 118547610 intron probably benign
R5298:Clasp1 UTSW 1 118547920 missense possibly damaging 0.71
R5485:Clasp1 UTSW 1 118467913 missense possibly damaging 0.95
R5516:Clasp1 UTSW 1 118497721 missense probably damaging 1.00
R5821:Clasp1 UTSW 1 118590484 missense probably damaging 1.00
R5911:Clasp1 UTSW 1 118506908 unclassified probably benign
R6092:Clasp1 UTSW 1 118510298 missense probably damaging 0.97
R6181:Clasp1 UTSW 1 118419817 missense probably benign 0.18
R6478:Clasp1 UTSW 1 118512180 nonsense probably null
R7090:Clasp1 UTSW 1 118482086 missense probably benign 0.45
R7216:Clasp1 UTSW 1 118547918 missense probably benign 0.00
R7508:Clasp1 UTSW 1 118545434 missense probably benign 0.30
R7541:Clasp1 UTSW 1 118542997 intron probably null
R7910:Clasp1 UTSW 1 118602414 nonsense probably null
R7991:Clasp1 UTSW 1 118602414 nonsense probably null
R8074:Clasp1 UTSW 1 118462483 missense probably benign
V7581:Clasp1 UTSW 1 118581348 missense probably damaging 1.00
X0028:Clasp1 UTSW 1 118551125 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAGCTCTTGTTTTGATGACTCCTG -3'
(R):5'- CCAAGGGGCTAGAAATGTGATTC -3'

Sequencing Primer
(F):5'- ATGACTCCTGTCTTACTGTGAAGAG -3'
(R):5'- GCCAGTAATCTCAGCTGTTAAGG -3'
Posted On2019-06-07