Incidental Mutation 'PIT4585001:Aurka'
ID556588
Institutional Source Beutler Lab
Gene Symbol Aurka
Ensembl Gene ENSMUSG00000027496
Gene Nameaurora kinase A
SynonymsIAK, IAK1, Aurora-A, aurora A, Ark1, Ayk1, AIRK1, Stk6
Accession Numbers

Ncbi RefSeq: NM_011497.3; MGI:894678

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location172356190-172370535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172357197 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 318 (M318V)
Ref Sequence ENSEMBL: ENSMUSP00000028997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028995] [ENSMUST00000028997] [ENSMUST00000109139] [ENSMUST00000109140]
PDB Structure
Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-{5-[2-(thieno[3,2-d]pyrimidin-4-ylamino)-ethyl]- thiazol-2-yl}-3-(3-trifluoromethyl-phenyl)-urea [X-RAY DIFFRACTION]
Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-(3-chloro-phenyl)-3-{5-[2-(thieno[3,2-d]pyrimidin-4-ylamino)- ethyl]-thiazol-2-yl}-urea [SNS-314] [X-RAY DIFFRACTION]
Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with 1-{5-[2-(1-methyl-1H-pyrazolo[4,3-d]pyrimidin-7-ylamino)-ethyl]-thiazol-2-yl}-3-(3-trifluoromethyl-phenyl)-urea [X-RAY DIFFRACTION]
Crystal structure of mouse Aurora A (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with [7-(2-{2-[3-(3-chloro-phenyl)-ureido]-thiazol-5-yl}-ethylamino)-pyrazolo[4,3-d]pyrimidin-1-yl]-acetic acid [X-RAY DIFFRACTION]
Crystal structure of Aurora A complexed with an inhibitor discovered through site-directed dynamic tethering [X-RAY DIFFRACTION]
Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 290. [X-RAY DIFFRACTION]
Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 823. [X-RAY DIFFRACTION]
Crystal structure of the mouse Aurora-A catalytic domain (Asn186->Gly, Lys240->Arg, Met302->Leu) in complex with Compound 130. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028995
SMART Domains Protein: ENSMUSP00000028995
Gene: ENSMUSG00000027495

DomainStartEndE-ValueType
Pfam:DUF1279 85 172 4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028997
AA Change: M318V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028997
Gene: ENSMUSG00000027496
AA Change: M318V

DomainStartEndE-ValueType
S_TKc 146 396 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109139
AA Change: M296V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104767
Gene: ENSMUSG00000027496
AA Change: M296V

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109140
AA Change: M296V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104768
Gene: ENSMUSG00000027496
AA Change: M296V

DomainStartEndE-ValueType
S_TKc 124 374 2.25e-99 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype Strain: 3836423; 3826513
Lethality: E1-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before implantation, early embryonic growth arrest, and impaired mitosis. Heterozygous null mice display increased incidence of tumors primarily lymphomas and chromosomal instability. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(4) Gene trapped(21)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Aurka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Aurka APN 2 172368979 unclassified probably benign
IGL02338:Aurka APN 2 172359858 missense probably benign 0.00
IGL02894:Aurka APN 2 172366948 unclassified probably null
IGL03188:Aurka APN 2 172363768 missense possibly damaging 0.60
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0006:Aurka UTSW 2 172359753 critical splice donor site probably null
R0458:Aurka UTSW 2 172370446 nonsense probably null
R0555:Aurka UTSW 2 172367147 missense probably benign 0.07
R1130:Aurka UTSW 2 172357258 splice site probably null
R1140:Aurka UTSW 2 172357229 missense probably damaging 1.00
R2507:Aurka UTSW 2 172370445 missense probably benign 0.00
R2887:Aurka UTSW 2 172367120 missense probably benign 0.01
R2889:Aurka UTSW 2 172367120 missense probably benign 0.01
R3772:Aurka UTSW 2 172366960 missense probably benign
R4929:Aurka UTSW 2 172370406 missense probably benign 0.05
R5409:Aurka UTSW 2 172367116 missense possibly damaging 0.78
R6158:Aurka UTSW 2 172363596 critical splice donor site probably null
R6689:Aurka UTSW 2 172370393 critical splice donor site probably null
R6828:Aurka UTSW 2 172357252 missense probably damaging 1.00
R7912:Aurka UTSW 2 172369029 missense probably benign 0.00
R7993:Aurka UTSW 2 172369029 missense probably benign 0.00
R8066:Aurka UTSW 2 172370418 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAACACAAGCATGGGTCAGAG -3'
(R):5'- TGAACAGCCGTAGACGTGAG -3'

Sequencing Primer
(F):5'- CATGGGTCAGAGGTGAACATG -3'
(R):5'- AAGTTTGGTGGCTCCATGC -3'
Posted On2019-06-07