Incidental Mutation 'PIT4585001:Unc13b'
ID556590
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Nameunc-13 homolog B (C. elegans)
SynonymsUnc13h2, Munc13-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43058953-43264871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43091298 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 41 (D41E)
Ref Sequence ENSEMBL: ENSMUSP00000103586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
Predicted Effect probably benign
Transcript: ENSMUST00000079978
AA Change: D41E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: D41E

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
AA Change: D41E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: D41E

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
AA Change: D41E

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: D41E

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163653
AA Change: D41E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: D41E

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000207569
AA Change: D41E
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTCTTGAAGAGCAGCCAC -3'
(R):5'- TGTACTTCACTACAAGCCTGAC -3'

Sequencing Primer
(F):5'- ACTGCTCTTGAATATTCTCTCCAG -3'
(R):5'- CTCCTCTCACTCTACAGATTAAAAAG -3'
Posted On2019-06-07