Incidental Mutation 'PIT4585001:Tas2r104'
ID556599
Institutional Source Beutler Lab
Gene Symbol Tas2r104
Ensembl Gene ENSMUSG00000061977
Gene Nametaste receptor, type 2, member 104
SynonymsT2R04, mGR04, Tas2r4, mt2r45
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location131684836-131685744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131685558 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 63 (T63A)
Ref Sequence ENSEMBL: ENSMUSP00000072237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053652] [ENSMUST00000072404] [ENSMUST00000080619]
Predicted Effect probably benign
Transcript: ENSMUST00000053652
SMART Domains Protein: ENSMUSP00000058006
Gene: ENSMUSG00000051153

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 9.4e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000072404
AA Change: T63A

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072237
Gene: ENSMUSG00000061977
AA Change: T63A

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080619
SMART Domains Protein: ENSMUSP00000079453
Gene: ENSMUSG00000063478

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 8.1e-104 PFAM
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Tas2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Tas2r104 APN 6 131685567 missense probably damaging 1.00
IGL01390:Tas2r104 APN 6 131685485 missense probably benign 0.13
IGL02751:Tas2r104 APN 6 131685144 missense probably damaging 1.00
R0218:Tas2r104 UTSW 6 131685092 missense probably damaging 1.00
R0453:Tas2r104 UTSW 6 131685341 missense probably benign 0.00
R0472:Tas2r104 UTSW 6 131685471 missense probably benign 0.06
R0614:Tas2r104 UTSW 6 131685202 missense probably damaging 1.00
R1290:Tas2r104 UTSW 6 131684845 nonsense probably null
R1480:Tas2r104 UTSW 6 131685294 missense probably benign 0.17
R1698:Tas2r104 UTSW 6 131685584 missense probably damaging 1.00
R2050:Tas2r104 UTSW 6 131685120 missense probably damaging 1.00
R2229:Tas2r104 UTSW 6 131685132 missense probably damaging 1.00
R3824:Tas2r104 UTSW 6 131685039 missense possibly damaging 0.55
R3852:Tas2r104 UTSW 6 131684925 missense probably benign 0.09
R4283:Tas2r104 UTSW 6 131685411 missense probably damaging 1.00
R4583:Tas2r104 UTSW 6 131685435 missense probably benign 0.00
R4710:Tas2r104 UTSW 6 131685444 missense probably damaging 0.96
R4954:Tas2r104 UTSW 6 131685005 missense probably damaging 0.99
R5559:Tas2r104 UTSW 6 131685131 missense probably damaging 1.00
R5765:Tas2r104 UTSW 6 131685273 missense probably benign
R5843:Tas2r104 UTSW 6 131684975 missense probably damaging 0.99
R7304:Tas2r104 UTSW 6 131685042 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTTCATCCAGAGAAATATGTAGTGGG -3'
(R):5'- TCCAGCAGAAGCCTTCTTGG -3'

Sequencing Primer
(F):5'- AGTGGGAAAAATTTGCTATCTTCAG -3'
(R):5'- AAGCCTTCTTGGAAACTGGC -3'
Posted On2019-06-07