Incidental Mutation 'PIT4585001:Slco1a6'
ID556601
Institutional Source Beutler Lab
Gene Symbol Slco1a6
Ensembl Gene ENSMUSG00000079262
Gene Namesolute carrier organic anion transporter family, member 1a6
SynonymsSlc21a13, organic anion-transporting polypeptide, 4930422F19Rik, Oatp-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location142085761-142208521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142109520 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 233 (T233A)
Ref Sequence ENSEMBL: ENSMUSP00000107458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111827]
Predicted Effect probably damaging
Transcript: ENSMUST00000111827
AA Change: T233A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107458
Gene: ENSMUSG00000079262
AA Change: T233A

DomainStartEndE-ValueType
Pfam:MFS_1 21 421 7.8e-26 PFAM
Pfam:OATP 21 597 1.3e-163 PFAM
Pfam:Kazal_2 445 486 2.7e-11 PFAM
transmembrane domain 600 619 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Slco1a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Slco1a6 APN 6 142161017 missense probably benign 0.00
IGL00430:Slco1a6 APN 6 142101651 nonsense probably null
IGL00541:Slco1a6 APN 6 142096299 missense possibly damaging 0.67
IGL01340:Slco1a6 APN 6 142109383 missense possibly damaging 0.71
IGL01693:Slco1a6 APN 6 142133209 nonsense probably null
IGL01713:Slco1a6 APN 6 142086567 missense possibly damaging 0.87
IGL01828:Slco1a6 APN 6 142096411 missense probably damaging 1.00
IGL02049:Slco1a6 APN 6 142101583 splice site probably benign
IGL02085:Slco1a6 APN 6 142086474 missense probably benign 0.00
IGL02245:Slco1a6 APN 6 142109424 missense probably damaging 1.00
IGL02549:Slco1a6 APN 6 142096415 splice site probably benign
IGL02698:Slco1a6 APN 6 142103011 nonsense probably null
IGL02948:Slco1a6 APN 6 142133235 splice site probably null
IGL03075:Slco1a6 APN 6 142103149 splice site probably benign
R0008:Slco1a6 UTSW 6 142157222 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0106:Slco1a6 UTSW 6 142157390 unclassified probably benign
R0173:Slco1a6 UTSW 6 142103122 missense probably benign 0.10
R1642:Slco1a6 UTSW 6 142086434 missense probably benign 0.00
R1939:Slco1a6 UTSW 6 142133230 missense probably damaging 1.00
R2256:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2257:Slco1a6 UTSW 6 142091016 missense probably benign 0.04
R2696:Slco1a6 UTSW 6 142112936 missense probably damaging 1.00
R2902:Slco1a6 UTSW 6 142096320 missense probably damaging 1.00
R4602:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4611:Slco1a6 UTSW 6 142101652 missense probably benign 0.00
R4958:Slco1a6 UTSW 6 142145705 missense probably damaging 1.00
R5256:Slco1a6 UTSW 6 142132701 missense probably benign 0.39
R5347:Slco1a6 UTSW 6 142086599 missense probably damaging 0.98
R6130:Slco1a6 UTSW 6 142086429 missense probably benign 0.26
R6384:Slco1a6 UTSW 6 142109379 missense probably benign 0.01
R6543:Slco1a6 UTSW 6 142133146 missense probably benign 0.00
R6662:Slco1a6 UTSW 6 142133215 missense probably damaging 0.97
R6687:Slco1a6 UTSW 6 142099350 missense possibly damaging 0.91
R6702:Slco1a6 UTSW 6 142103100 missense probably damaging 0.99
R7012:Slco1a6 UTSW 6 142086561 missense probably benign 0.02
R7140:Slco1a6 UTSW 6 142103019 missense probably benign 0.00
R7392:Slco1a6 UTSW 6 142157277 missense probably benign 0.00
R7399:Slco1a6 UTSW 6 142091068 missense probably benign 0.01
R7476:Slco1a6 UTSW 6 142103001 missense possibly damaging 0.71
R7621:Slco1a6 UTSW 6 142161017 missense probably damaging 0.96
R7633:Slco1a6 UTSW 6 142145755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCACACGTGACAAGTG -3'
(R):5'- CGGTCAGAATTATCCCAGTGGG -3'

Sequencing Primer
(F):5'- ACGTGACAAGTGCCCACTG -3'
(R):5'- GCGATGCCAGTAATCCCAG -3'
Posted On2019-06-07