Incidental Mutation 'PIT4585001:Rcn3'
ID556604
Institutional Source Beutler Lab
Gene Symbol Rcn3
Ensembl Gene ENSMUSG00000019539
Gene Namereticulocalbin 3, EF-hand calcium binding domain
SynonymsD530026G20Rik, RLP49, D7Ertd671e, 6030455P07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4585001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45082913-45092221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45086694 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 197 (F197L)
Ref Sequence ENSEMBL: ENSMUSP00000019683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019683] [ENSMUST00000209761] [ENSMUST00000210469] [ENSMUST00000210527] [ENSMUST00000210734] [ENSMUST00000211352]
Predicted Effect probably benign
Transcript: ENSMUST00000019683
AA Change: F197L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019683
Gene: ENSMUSG00000019539
AA Change: F197L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:EFh 79 109 9e-9 BLAST
EFh 117 145 1.23e1 SMART
Blast:EFh 167 195 1e-7 BLAST
EFh 204 232 1.62e0 SMART
Blast:EFh 244 272 7e-6 BLAST
EFh 281 309 1.64e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209761
AA Change: F121L

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000210469
AA Change: F197L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000210527
Predicted Effect probably benign
Transcript: ENSMUST00000210734
AA Change: F197L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000211352
AA Change: F197L

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Rcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Rcn3 APN 7 45083338 missense probably damaging 1.00
IGL02370:Rcn3 APN 7 45083333 missense probably benign
R0321:Rcn3 UTSW 7 45088715 unclassified probably benign
R2270:Rcn3 UTSW 7 45088651 missense probably damaging 0.99
R4634:Rcn3 UTSW 7 45088668 missense probably damaging 1.00
R5268:Rcn3 UTSW 7 45086779 missense probably damaging 1.00
R6104:Rcn3 UTSW 7 45091523 missense probably damaging 1.00
R6228:Rcn3 UTSW 7 45083296 missense probably damaging 0.98
R7199:Rcn3 UTSW 7 45084909 missense probably damaging 1.00
R7851:Rcn3 UTSW 7 45086812 missense probably benign 0.23
R7934:Rcn3 UTSW 7 45086812 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCTGGAGATTGGACACCTAATG -3'
(R):5'- TGTGGCAGTCCTTCCACTAG -3'

Sequencing Primer
(F):5'- TGGAACACAGGAAGGTCTGATAAAG -3'
(R):5'- AGTCCTTCCACTAGCTGGG -3'
Posted On2019-06-07