Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4585001:Nup93'

556607

Institutional Source

Beutler Lab

Gene Symbol

Nup93

Ensembl Gene

ENSMUSG00000032939

Gene Name

nucleoporin 93

Synonyms

2410008G02Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.914) question?

Stock #

PIT4585001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94214564-94317227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94243727 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 85 (T85S)

Ref Sequence

ENSEMBL: ENSMUSP00000078878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000212824]

AlphaFold

Q8BJ71

Predicted Effect

probably benign
Transcript: ENSMUST00000079961
AA Change: T85S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: T85S

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	214	804	6.9e-198	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109547
AA Change: T85S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: T85S

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	202	804	8.2e-202	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212824
AA Change: T85S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,357,197	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,326,344	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,982,976	T202S	probably benign	Het
Ccdc155	C	T	7: 45,200,271	G76D	probably benign	Het
Cdc42bpb	T	C	12: 111,304,978	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,462,555	N156K	probably damaging	Het
Cox18	G	A	5: 90,217,575	T255I	possibly damaging	Het
Cse1l	A	G	2: 166,941,474	T783A	probably damaging	Het
Dnajc16	T	C	4: 141,764,685	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,006,630	T339A	probably benign	Het
Eif5a	T	C	11: 69,918,070		probably benign	Het
Epha3	A	G	16: 63,566,577		probably null	Het
Esco1	A	T	18: 10,594,355	C310*	probably null	Het
Fam208b	G	A	13: 3,574,979	A1657V	possibly damaging	Het
Fam222a	A	G	5: 114,611,040	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,605,747	L339P	probably damaging	Het
Gfral	A	T	9: 76,197,294	N145K	probably damaging	Het
Gga1	T	A	15: 78,893,790	N618K	probably benign	Het
Gpatch3	T	A	4: 133,583,086	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,509,403	R346*	probably null	Het
Gsg1	T	C	6: 135,237,560	E317G	probably benign	Het
Gsk3b	A	G	16: 38,184,454	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,348,955	D94E	possibly damaging	Het
Klhdc9	T	A	1: 171,359,818	H204L	possibly damaging	Het
Klhl24	A	G	16: 20,106,888	I55M	probably benign	Het
Kmt2c	T	C	5: 25,315,106	D2002G	probably benign	Het
Lama4	A	G	10: 39,074,746	N1015S	probably damaging	Het
Lpp	T	C	16: 24,761,947	C263R	probably benign	Het
Lrp1b	T	C	2: 41,269,204	I1689V		Het
Mipep	C	A	14: 60,784,835	Q50K	probably benign	Het
Mx1	T	C	16: 97,456,254	D101G	probably benign	Het
Nabp2	C	G	10: 128,408,807	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,842,036	I115V	possibly damaging	Het
Oit3	T	A	10: 59,431,013	I224F	possibly damaging	Het
Parp14	T	C	16: 35,858,605	K331R	probably benign	Het
Pls1	T	A	9: 95,761,390	T519S	probably benign	Het
Rcn3	A	G	7: 45,086,694	F197L	probably benign	Het
Rnf213	C	T	11: 119,458,392	T3773I		Het
Rprd1b	A	T	2: 158,047,957	I153L	probably benign	Het
Scel	A	G	14: 103,592,368	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,910,076	S548L	possibly damaging	Het
Sim1	T	A	10: 50,984,188	Y715*	probably null	Het
Slc18a2	A	T	19: 59,293,861	Q500L	possibly damaging	Het
Slc5a8	T	G	10: 88,886,503	M66R	probably damaging	Het
Slco1a6	T	C	6: 142,109,520	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623	T396A	probably benign	Het
Tas2r104	T	C	6: 131,685,558	T63A	possibly damaging	Het
Top2a	C	T	11: 99,001,373	A1088T	probably benign	Het
Ucp1	T	C	8: 83,293,948	F129S	probably damaging	Het
Unc13b	T	A	4: 43,091,298	D41E	probably benign	Het
Usp10	T	G	8: 119,954,892	V696G	probably benign	Het
Xylt2	C	T	11: 94,666,240	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,216,476	N41K	probably damaging	Het
Zfp109	T	A	7: 24,229,354	D218V	probably benign	Het
Zfp420	G	A	7: 29,876,005	R550Q	probably benign	Het

Other mutations in Nup93

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Nup93	APN	8	94309023	critical splice donor site	probably null
IGL01652:Nup93	APN	8	94296559	missense	possibly damaging	0.93
IGL02003:Nup93	APN	8	94302109	nonsense	probably null
IGL02169:Nup93	APN	8	94302129	missense	probably damaging	1.00
IGL02212:Nup93	APN	8	94311662	critical splice donor site	probably null
IGL02551:Nup93	APN	8	94227833	nonsense	probably null
IGL02568:Nup93	APN	8	94309635	missense	probably damaging	1.00
IGL03094:Nup93	APN	8	94296502	missense	probably benign
IGL03248:Nup93	APN	8	94306088	missense	probably damaging	0.98
IGL03273:Nup93	APN	8	94306277	missense	probably benign	0.01
IGL03401:Nup93	APN	8	94309711	splice site	probably null
R0409:Nup93	UTSW	8	94303665	missense	probably damaging	1.00
R0748:Nup93	UTSW	8	94307943	missense	probably damaging	1.00
R0891:Nup93	UTSW	8	94281263	splice site	probably benign
R1667:Nup93	UTSW	8	94292687	missense	possibly damaging	0.71
R1696:Nup93	UTSW	8	94296555	missense	probably benign	0.29
R1862:Nup93	UTSW	8	94306102	missense	probably damaging	1.00
R2069:Nup93	UTSW	8	94243739	missense	probably damaging	1.00
R2143:Nup93	UTSW	8	94296480	nonsense	probably null
R2187:Nup93	UTSW	8	94300850	missense	probably damaging	1.00
R2228:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2229:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2254:Nup93	UTSW	8	94227857	critical splice donor site	probably null
R2884:Nup93	UTSW	8	94303638	missense	probably damaging	1.00
R4521:Nup93	UTSW	8	94314636	missense	probably damaging	1.00
R4563:Nup93	UTSW	8	94307892	missense	probably damaging	1.00
R4900:Nup93	UTSW	8	94286603	missense	probably benign	0.25
R5570:Nup93	UTSW	8	94314670	missense	probably damaging	1.00
R6226:Nup93	UTSW	8	94286537	missense	probably damaging	1.00
R6489:Nup93	UTSW	8	94302088	missense	probably benign	0.10
R6658:Nup93	UTSW	8	94304179	missense	probably benign	0.02
R6817:Nup93	UTSW	8	94314682	critical splice donor site	probably null
R6895:Nup93	UTSW	8	94243686	missense	probably damaging	1.00
R6955:Nup93	UTSW	8	94309673	missense	probably damaging	0.96
R7476:Nup93	UTSW	8	94303632	missense	probably damaging	1.00
R7643:Nup93	UTSW	8	94286619	critical splice donor site	probably null
R7994:Nup93	UTSW	8	94306302	missense	probably benign	0.15
R8461:Nup93	UTSW	8	94281335	critical splice donor site	probably null
R9177:Nup93	UTSW	8	94227743	missense	probably benign	0.25
R9264:Nup93	UTSW	8	94292720	missense	probably benign	0.01
R9532:Nup93	UTSW	8	94314621	missense	probably damaging	1.00
R9567:Nup93	UTSW	8	94308976	missense	possibly damaging	0.94
R9629:Nup93	UTSW	8	94306639	missense	probably damaging	0.99
R9721:Nup93	UTSW	8	94303685	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTTTCCAGTCAGGTGCTC -3'
(R):5'- CTCTTGTGTTCCTCGGTAAGAAG -3'

Sequencing Primer
(F):5'- TCCTAGTTCTACTCCATGGTAGG -3'
(R):5'- TACAAGCTCTACTGTGCC -3'

Posted On

2019-06-07