Incidental Mutation 'PIT4585001:Nup93'
ID 556607
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # PIT4585001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 94941192-95043855 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 94970355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 85 (T85S)
Ref Sequence ENSEMBL: ENSMUSP00000078878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect probably benign
Transcript: ENSMUST00000079961
AA Change: T85S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: T85S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109547
AA Change: T85S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: T85S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212824
AA Change: T85S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,199,117 (GRCm39) M318V probably benign Het
Cacna2d1 T A 5: 16,531,342 (GRCm39) D560E probably damaging Het
Ccdc148 T A 2: 58,872,988 (GRCm39) T202S probably benign Het
Cdc42bpb T C 12: 111,271,412 (GRCm39) D1149G probably damaging Het
Clasp1 T A 1: 118,390,285 (GRCm39) N156K probably damaging Het
Cox18 G A 5: 90,365,434 (GRCm39) T255I possibly damaging Het
Cse1l A G 2: 166,783,394 (GRCm39) T783A probably damaging Het
Dnajc16 T C 4: 141,491,996 (GRCm39) Y609C probably damaging Het
Doc2g A G 19: 4,056,630 (GRCm39) T339A probably benign Het
Eif5a T C 11: 69,808,896 (GRCm39) probably benign Het
Epha3 A G 16: 63,386,940 (GRCm39) probably null Het
Esco1 A T 18: 10,594,355 (GRCm39) C310* probably null Het
Fam222a A G 5: 114,749,101 (GRCm39) Y99C probably damaging Het
Fzd2 T C 11: 102,496,573 (GRCm39) L339P probably damaging Het
Gfral A T 9: 76,104,576 (GRCm39) N145K probably damaging Het
Gga1 T A 15: 78,777,990 (GRCm39) N618K probably benign Het
Gpatch3 T A 4: 133,310,397 (GRCm39) H447Q probably damaging Het
Gpn1 A T 5: 31,666,747 (GRCm39) R346* probably null Het
Gsg1 T C 6: 135,214,558 (GRCm39) E317G probably benign Het
Gsk3b A G 16: 38,004,816 (GRCm39) N129S probably damaging Het
Hmg20b G T 10: 81,184,789 (GRCm39) D94E possibly damaging Het
Kash5 C T 7: 44,849,695 (GRCm39) G76D probably benign Het
Klhdc9 T A 1: 171,187,386 (GRCm39) H204L possibly damaging Het
Klhl24 A G 16: 19,925,638 (GRCm39) I55M probably benign Het
Kmt2c T C 5: 25,520,104 (GRCm39) D2002G probably benign Het
Lama4 A G 10: 38,950,742 (GRCm39) N1015S probably damaging Het
Lpp T C 16: 24,580,697 (GRCm39) C263R probably benign Het
Lrp1b T C 2: 41,159,216 (GRCm39) I1689V Het
Mipep C A 14: 61,022,284 (GRCm39) Q50K probably benign Het
Mx1 T C 16: 97,257,454 (GRCm39) D101G probably benign Het
Nabp2 C G 10: 128,244,676 (GRCm39) E37Q possibly damaging Het
Nme6 A G 9: 109,671,104 (GRCm39) I115V possibly damaging Het
Oit3 T A 10: 59,266,835 (GRCm39) I224F possibly damaging Het
Parp14 T C 16: 35,678,975 (GRCm39) K331R probably benign Het
Pls1 T A 9: 95,643,443 (GRCm39) T519S probably benign Het
Rcn3 A G 7: 44,736,118 (GRCm39) F197L probably benign Het
Rnf213 C T 11: 119,349,218 (GRCm39) T3773I Het
Rprd1b A T 2: 157,889,877 (GRCm39) I153L probably benign Het
Scel A G 14: 103,829,804 (GRCm39) D462G possibly damaging Het
Sh3bp1 C T 15: 78,794,276 (GRCm39) S548L possibly damaging Het
Sim1 T A 10: 50,860,284 (GRCm39) Y715* probably null Het
Slc18a2 A T 19: 59,282,293 (GRCm39) Q500L possibly damaging Het
Slc5a8 T G 10: 88,722,365 (GRCm39) M66R probably damaging Het
Slco1a6 T C 6: 142,055,246 (GRCm39) T233A probably damaging Het
Smu1 T C 4: 40,739,623 (GRCm39) T396A probably benign Het
Tas2r104 T C 6: 131,662,521 (GRCm39) T63A possibly damaging Het
Tasor2 G A 13: 3,624,979 (GRCm39) A1657V possibly damaging Het
Top2a C T 11: 98,892,199 (GRCm39) A1088T probably benign Het
Ucp1 T C 8: 84,020,577 (GRCm39) F129S probably damaging Het
Unc13b T A 4: 43,091,298 (GRCm39) D41E probably benign Het
Usp10 T G 8: 120,681,631 (GRCm39) V696G probably benign Het
Xylt2 C T 11: 94,557,066 (GRCm39) V745M probably damaging Het
Zbtb49 A T 5: 38,373,820 (GRCm39) N41K probably damaging Het
Zfp109 T A 7: 23,928,779 (GRCm39) D218V probably benign Het
Zfp420 G A 7: 29,575,430 (GRCm39) R550Q probably benign Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 95,035,651 (GRCm39) critical splice donor site probably null
IGL01652:Nup93 APN 8 95,023,187 (GRCm39) missense possibly damaging 0.93
IGL02003:Nup93 APN 8 95,028,737 (GRCm39) nonsense probably null
IGL02169:Nup93 APN 8 95,028,757 (GRCm39) missense probably damaging 1.00
IGL02212:Nup93 APN 8 95,038,290 (GRCm39) critical splice donor site probably null
IGL02551:Nup93 APN 8 94,954,461 (GRCm39) nonsense probably null
IGL02568:Nup93 APN 8 95,036,263 (GRCm39) missense probably damaging 1.00
IGL03094:Nup93 APN 8 95,023,130 (GRCm39) missense probably benign
IGL03248:Nup93 APN 8 95,032,716 (GRCm39) missense probably damaging 0.98
IGL03273:Nup93 APN 8 95,032,905 (GRCm39) missense probably benign 0.01
IGL03401:Nup93 APN 8 95,036,339 (GRCm39) splice site probably null
R0409:Nup93 UTSW 8 95,030,293 (GRCm39) missense probably damaging 1.00
R0748:Nup93 UTSW 8 95,034,571 (GRCm39) missense probably damaging 1.00
R0891:Nup93 UTSW 8 95,007,891 (GRCm39) splice site probably benign
R1667:Nup93 UTSW 8 95,019,315 (GRCm39) missense possibly damaging 0.71
R1696:Nup93 UTSW 8 95,023,183 (GRCm39) missense probably benign 0.29
R1862:Nup93 UTSW 8 95,032,730 (GRCm39) missense probably damaging 1.00
R2069:Nup93 UTSW 8 94,970,367 (GRCm39) missense probably damaging 1.00
R2143:Nup93 UTSW 8 95,023,108 (GRCm39) nonsense probably null
R2187:Nup93 UTSW 8 95,027,478 (GRCm39) missense probably damaging 1.00
R2228:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2229:Nup93 UTSW 8 95,030,819 (GRCm39) missense probably benign 0.27
R2254:Nup93 UTSW 8 94,954,485 (GRCm39) critical splice donor site probably null
R2884:Nup93 UTSW 8 95,030,266 (GRCm39) missense probably damaging 1.00
R4521:Nup93 UTSW 8 95,041,264 (GRCm39) missense probably damaging 1.00
R4563:Nup93 UTSW 8 95,034,520 (GRCm39) missense probably damaging 1.00
R4900:Nup93 UTSW 8 95,013,231 (GRCm39) missense probably benign 0.25
R5570:Nup93 UTSW 8 95,041,298 (GRCm39) missense probably damaging 1.00
R6226:Nup93 UTSW 8 95,013,165 (GRCm39) missense probably damaging 1.00
R6489:Nup93 UTSW 8 95,028,716 (GRCm39) missense probably benign 0.10
R6658:Nup93 UTSW 8 95,030,807 (GRCm39) missense probably benign 0.02
R6817:Nup93 UTSW 8 95,041,310 (GRCm39) critical splice donor site probably null
R6895:Nup93 UTSW 8 94,970,314 (GRCm39) missense probably damaging 1.00
R6955:Nup93 UTSW 8 95,036,301 (GRCm39) missense probably damaging 0.96
R7476:Nup93 UTSW 8 95,030,260 (GRCm39) missense probably damaging 1.00
R7643:Nup93 UTSW 8 95,013,247 (GRCm39) critical splice donor site probably null
R7994:Nup93 UTSW 8 95,032,930 (GRCm39) missense probably benign 0.15
R8461:Nup93 UTSW 8 95,007,963 (GRCm39) critical splice donor site probably null
R9177:Nup93 UTSW 8 94,954,371 (GRCm39) missense probably benign 0.25
R9264:Nup93 UTSW 8 95,019,348 (GRCm39) missense probably benign 0.01
R9532:Nup93 UTSW 8 95,041,249 (GRCm39) missense probably damaging 1.00
R9567:Nup93 UTSW 8 95,035,604 (GRCm39) missense possibly damaging 0.94
R9629:Nup93 UTSW 8 95,033,267 (GRCm39) missense probably damaging 0.99
R9721:Nup93 UTSW 8 95,030,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTTCCAGTCAGGTGCTC -3'
(R):5'- CTCTTGTGTTCCTCGGTAAGAAG -3'

Sequencing Primer
(F):5'- TCCTAGTTCTACTCCATGGTAGG -3'
(R):5'- TACAAGCTCTACTGTGCC -3'
Posted On 2019-06-07