Incidental Mutation 'PIT4585001:Usp10'
ID556608
Institutional Source Beutler Lab
Gene Symbol Usp10
Ensembl Gene ENSMUSG00000031826
Gene Nameubiquitin specific peptidase 10
SynonymsUchrp, 2610014N07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4585001 (G1)
Quality Score163.009
Status Not validated
Chromosome8
Chromosomal Location119910360-119957560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119954892 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 696 (V696G)
Ref Sequence ENSEMBL: ENSMUSP00000123590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108982] [ENSMUST00000108988] [ENSMUST00000127664] [ENSMUST00000144458]
Predicted Effect probably benign
Transcript: ENSMUST00000108982
SMART Domains Protein: ENSMUSP00000104610
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
Pfam:UCH 9 113 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108988
AA Change: V695G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104616
Gene: ENSMUSG00000031826
AA Change: V695G

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
low complexity region 147 155 N/A INTRINSIC
Pfam:UCH 408 786 9.3e-48 PFAM
Pfam:UCH_1 409 764 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134729
SMART Domains Protein: ENSMUSP00000134182
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144458
AA Change: V696G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123590
Gene: ENSMUSG00000031826
AA Change: V696G

DomainStartEndE-ValueType
Pfam:PAM2 78 95 1.1e-7 PFAM
low complexity region 118 132 N/A INTRINSIC
low complexity region 148 156 N/A INTRINSIC
Pfam:UCH 409 787 1.2e-44 PFAM
Pfam:UCH_1 410 765 4.2e-18 PFAM
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in arsenite-induced stress granule formation, reactive oxygen species (ROS) production, and ROS-dependent apoptosis in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Oit3 T A 10: 59,431,013 I224F possibly damaging Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Usp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Usp10 APN 8 119948741 missense possibly damaging 0.95
IGL02444:Usp10 APN 8 119948693 missense possibly damaging 0.70
IGL02487:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02526:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02951:Usp10 APN 8 119947086 missense probably benign 0.01
IGL03003:Usp10 APN 8 119954810 missense possibly damaging 0.90
IGL03049:Usp10 APN 8 119956627 missense probably benign 0.01
R0090:Usp10 UTSW 8 119953196 nonsense probably null
R0329:Usp10 UTSW 8 119936557 nonsense probably null
R0550:Usp10 UTSW 8 119947801 missense probably damaging 0.98
R2349:Usp10 UTSW 8 119956709 makesense probably null
R4345:Usp10 UTSW 8 119954814 missense probably damaging 1.00
R4782:Usp10 UTSW 8 119941191 missense probably benign 0.03
R5182:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5184:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5461:Usp10 UTSW 8 119956667 missense probably benign 0.44
R5749:Usp10 UTSW 8 119941133 missense probably damaging 0.99
R5873:Usp10 UTSW 8 119947092 missense possibly damaging 0.60
R5935:Usp10 UTSW 8 119947089 missense possibly damaging 0.74
R6242:Usp10 UTSW 8 119941838 missense probably benign 0.01
R6362:Usp10 UTSW 8 119941316 missense probably benign 0.00
R6608:Usp10 UTSW 8 119948422 missense probably benign 0.06
R6774:Usp10 UTSW 8 119951972 missense probably benign
R7148:Usp10 UTSW 8 119936550 missense possibly damaging 0.47
R7164:Usp10 UTSW 8 119942108 missense probably damaging 1.00
R7238:Usp10 UTSW 8 119941544 missense probably benign
R7310:Usp10 UTSW 8 119941605 missense possibly damaging 0.89
R7792:Usp10 UTSW 8 119952001 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ATGGCTCAGTTGCAGGTGTC -3'
(R):5'- GTTTTGCTACTACCTGCACCAG -3'

Sequencing Primer
(F):5'- CTCAGTTGCAGGTGTCCATAG -3'
(R):5'- GCTCAGTAGTTTAAAGACCACTGGC -3'
Posted On2019-06-07