Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4585001:Pls1'

556610

Institutional Source

Beutler Lab

Gene Symbol

Pls1

Ensembl Gene

ENSMUSG00000049493

Gene Name

plastin 1 (I-isoform)

Synonyms

I-fimbrin

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

PIT4585001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95752642-95845311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 95761390 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 519 (T519S)

Ref Sequence

ENSEMBL: ENSMUSP00000091317 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093800]

Predicted Effect

probably benign
Transcript: ENSMUST00000093800
AA Change: T519S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000091317
Gene: ENSMUSG00000049493
AA Change: T519S

Domain	Start	End	E-Value	Type
EFh	15	43	8.5e-5	SMART
EFh	55	83	1.73e-5	SMART
low complexity region	100	116	N/A	INTRINSIC
CH	124	236	3.69e-23	SMART
CH	268	375	4.4e-21	SMART
CH	398	503	7.27e-22	SMART
CH	519	624	3.75e-15	SMART

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. The protein encoded by this gene is a third distinct plastin isoform, which is specifically expressed at high levels in the small intestine. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation for this gene leads to altered intestinal morphology and physiology, increased brush border fragility and susceptibility to induced colitis, as well as a moderate and progressive form of hearing loss associated with defects in stereocilia morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,357,197	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,326,344	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,982,976	T202S	probably benign	Het
Ccdc155	C	T	7: 45,200,271	G76D	probably benign	Het
Cdc42bpb	T	C	12: 111,304,978	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,462,555	N156K	probably damaging	Het
Cox18	G	A	5: 90,217,575	T255I	possibly damaging	Het
Cse1l	A	G	2: 166,941,474	T783A	probably damaging	Het
Dnajc16	T	C	4: 141,764,685	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,006,630	T339A	probably benign	Het
Eif5a	T	C	11: 69,918,070		probably benign	Het
Epha3	A	G	16: 63,566,577		probably null	Het
Esco1	A	T	18: 10,594,355	C310*	probably null	Het
Fam208b	G	A	13: 3,574,979	A1657V	possibly damaging	Het
Fam222a	A	G	5: 114,611,040	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,605,747	L339P	probably damaging	Het
Gfral	A	T	9: 76,197,294	N145K	probably damaging	Het
Gga1	T	A	15: 78,893,790	N618K	probably benign	Het
Gpatch3	T	A	4: 133,583,086	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,509,403	R346*	probably null	Het
Gsg1	T	C	6: 135,237,560	E317G	probably benign	Het
Gsk3b	A	G	16: 38,184,454	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,348,955	D94E	possibly damaging	Het
Klhdc9	T	A	1: 171,359,818	H204L	possibly damaging	Het
Klhl24	A	G	16: 20,106,888	I55M	probably benign	Het
Kmt2c	T	C	5: 25,315,106	D2002G	probably benign	Het
Lama4	A	G	10: 39,074,746	N1015S	probably damaging	Het
Lpp	T	C	16: 24,761,947	C263R	probably benign	Het
Lrp1b	T	C	2: 41,269,204	I1689V		Het
Mipep	C	A	14: 60,784,835	Q50K	probably benign	Het
Mx1	T	C	16: 97,456,254	D101G	probably benign	Het
Nabp2	C	G	10: 128,408,807	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,842,036	I115V	possibly damaging	Het
Nup93	A	T	8: 94,243,727	T85S	probably benign	Het
Oit3	T	A	10: 59,431,013	I224F	possibly damaging	Het
Parp14	T	C	16: 35,858,605	K331R	probably benign	Het
Rcn3	A	G	7: 45,086,694	F197L	probably benign	Het
Rnf213	C	T	11: 119,458,392	T3773I		Het
Rprd1b	A	T	2: 158,047,957	I153L	probably benign	Het
Scel	A	G	14: 103,592,368	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,910,076	S548L	possibly damaging	Het
Sim1	T	A	10: 50,984,188	Y715*	probably null	Het
Slc18a2	A	T	19: 59,293,861	Q500L	possibly damaging	Het
Slc5a8	T	G	10: 88,886,503	M66R	probably damaging	Het
Slco1a6	T	C	6: 142,109,520	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623	T396A	probably benign	Het
Tas2r104	T	C	6: 131,685,558	T63A	possibly damaging	Het
Top2a	C	T	11: 99,001,373	A1088T	probably benign	Het
Ucp1	T	C	8: 83,293,948	F129S	probably damaging	Het
Unc13b	T	A	4: 43,091,298	D41E	probably benign	Het
Usp10	T	G	8: 119,954,892	V696G	probably benign	Het
Xylt2	C	T	11: 94,666,240	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,216,476	N41K	probably damaging	Het
Zfp109	T	A	7: 24,229,354	D218V	probably benign	Het
Zfp420	G	A	7: 29,876,005	R550Q	probably benign	Het

Other mutations in Pls1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Pls1	APN	9	95782419	missense	possibly damaging	0.95
IGL00836:Pls1	APN	9	95761422	missense	possibly damaging	0.86
IGL01391:Pls1	APN	9	95773698	missense	probably benign	0.38
IGL02335:Pls1	APN	9	95784183	missense	probably benign	0.32
IGL02875:Pls1	APN	9	95754351	missense	possibly damaging	0.93
IGL03081:Pls1	APN	9	95773643	missense	probably damaging	1.00
IGL03271:Pls1	APN	9	95776830	missense	probably benign	0.04
R0048:Pls1	UTSW	9	95787063	missense	probably damaging	1.00
R0088:Pls1	UTSW	9	95795768	missense	possibly damaging	0.93
R0409:Pls1	UTSW	9	95786919	splice site	probably benign
R2015:Pls1	UTSW	9	95761365	missense	possibly damaging	0.77
R2516:Pls1	UTSW	9	95776563	missense	probably benign	0.00
R2985:Pls1	UTSW	9	95785582	missense	possibly damaging	0.73
R3964:Pls1	UTSW	9	95785612	missense	probably benign	0.00
R3965:Pls1	UTSW	9	95785612	missense	probably benign	0.00
R5240:Pls1	UTSW	9	95776622	splice site	probably null
R5681:Pls1	UTSW	9	95787012	missense	probably damaging	1.00
R6399:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6441:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6496:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6498:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R6499:Pls1	UTSW	9	95754745	missense	probably damaging	0.99
R7016:Pls1	UTSW	9	95786941	missense	probably damaging	1.00
R7177:Pls1	UTSW	9	95773559	missense	probably benign	0.01
R7458:Pls1	UTSW	9	95785507	missense	probably damaging	1.00
R7467:Pls1	UTSW	9	95769113	missense	possibly damaging	0.78
R7536:Pls1	UTSW	9	95762057	missense	probably damaging	1.00
R7553:Pls1	UTSW	9	95787087	missense	probably damaging	1.00
R7691:Pls1	UTSW	9	95773673	missense	probably benign	0.21
R7756:Pls1	UTSW	9	95776844	missense	probably benign	0.44
R7758:Pls1	UTSW	9	95776844	missense	probably benign	0.44
R7876:Pls1	UTSW	9	95785505	nonsense	probably null
R7959:Pls1	UTSW	9	95785505	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATGCCTAAATTCCTAGGTCATATG -3'
(R):5'- CCATCCTGCAGCTTCAGTTG -3'

Sequencing Primer
(F):5'- AAATTCCTAGGTCATATGTTTCTGGG -3'
(R):5'- AGCTTCAGTTGCACGGG -3'

Posted On

2019-06-07