Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4585001:Lama4'

556612

Institutional Source

Beutler Lab

Gene Symbol

Lama4

Ensembl Gene

ENSMUSG00000019846

Gene Name

laminin, alpha 4

Synonyms

laminin [a]4

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4585001 (G1)

Quality Score

171.009

Status

Not validated

Chromosome

Chromosomal Location

38965515-39110188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 39074746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1015 (N1015S)

Ref Sequence

ENSEMBL: ENSMUSP00000019992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019992]

AlphaFold

P97927

Predicted Effect

probably damaging
Transcript: ENSMUST00000019992
AA Change: N1015S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846
AA Change: N1015S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
EGF_Lam	82	129	1.95e-8	SMART
EGF_Lam	132	184	5.78e-11	SMART
EGF_Lam	187	238	9.83e-14	SMART
Pfam:Laminin_I	283	548	5.3e-71	PFAM
coiled coil region	658	685	N/A	INTRINSIC
LamG	850	1009	9.54e-11	SMART
LamG	1066	1205	5.9e-25	SMART
LamG	1250	1374	6.68e-24	SMART
LamG	1484	1619	1.54e-37	SMART
LamG	1661	1794	3.63e-34	SMART

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,357,197	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,326,344	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,982,976	T202S	probably benign	Het
Ccdc155	C	T	7: 45,200,271	G76D	probably benign	Het
Cdc42bpb	T	C	12: 111,304,978	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,462,555	N156K	probably damaging	Het
Cox18	G	A	5: 90,217,575	T255I	possibly damaging	Het
Cse1l	A	G	2: 166,941,474	T783A	probably damaging	Het
Dnajc16	T	C	4: 141,764,685	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,006,630	T339A	probably benign	Het
Eif5a	T	C	11: 69,918,070		probably benign	Het
Epha3	A	G	16: 63,566,577		probably null	Het
Esco1	A	T	18: 10,594,355	C310*	probably null	Het
Fam208b	G	A	13: 3,574,979	A1657V	possibly damaging	Het
Fam222a	A	G	5: 114,611,040	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,605,747	L339P	probably damaging	Het
Gfral	A	T	9: 76,197,294	N145K	probably damaging	Het
Gga1	T	A	15: 78,893,790	N618K	probably benign	Het
Gpatch3	T	A	4: 133,583,086	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,509,403	R346*	probably null	Het
Gsg1	T	C	6: 135,237,560	E317G	probably benign	Het
Gsk3b	A	G	16: 38,184,454	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,348,955	D94E	possibly damaging	Het
Klhdc9	T	A	1: 171,359,818	H204L	possibly damaging	Het
Klhl24	A	G	16: 20,106,888	I55M	probably benign	Het
Kmt2c	T	C	5: 25,315,106	D2002G	probably benign	Het
Lpp	T	C	16: 24,761,947	C263R	probably benign	Het
Lrp1b	T	C	2: 41,269,204	I1689V		Het
Mipep	C	A	14: 60,784,835	Q50K	probably benign	Het
Mx1	T	C	16: 97,456,254	D101G	probably benign	Het
Nabp2	C	G	10: 128,408,807	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,842,036	I115V	possibly damaging	Het
Nup93	A	T	8: 94,243,727	T85S	probably benign	Het
Oit3	T	A	10: 59,431,013	I224F	possibly damaging	Het
Parp14	T	C	16: 35,858,605	K331R	probably benign	Het
Pls1	T	A	9: 95,761,390	T519S	probably benign	Het
Rcn3	A	G	7: 45,086,694	F197L	probably benign	Het
Rnf213	C	T	11: 119,458,392	T3773I		Het
Rprd1b	A	T	2: 158,047,957	I153L	probably benign	Het
Scel	A	G	14: 103,592,368	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,910,076	S548L	possibly damaging	Het
Sim1	T	A	10: 50,984,188	Y715*	probably null	Het
Slc18a2	A	T	19: 59,293,861	Q500L	possibly damaging	Het
Slc5a8	T	G	10: 88,886,503	M66R	probably damaging	Het
Slco1a6	T	C	6: 142,109,520	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623	T396A	probably benign	Het
Tas2r104	T	C	6: 131,685,558	T63A	possibly damaging	Het
Top2a	C	T	11: 99,001,373	A1088T	probably benign	Het
Ucp1	T	C	8: 83,293,948	F129S	probably damaging	Het
Unc13b	T	A	4: 43,091,298	D41E	probably benign	Het
Usp10	T	G	8: 119,954,892	V696G	probably benign	Het
Xylt2	C	T	11: 94,666,240	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,216,476	N41K	probably damaging	Het
Zfp109	T	A	7: 24,229,354	D218V	probably benign	Het
Zfp420	G	A	7: 29,876,005	R550Q	probably benign	Het

Other mutations in Lama4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Lama4	APN	10	39065595	splice site	probably benign
IGL00091:Lama4	APN	10	39072805	missense	probably damaging	1.00
IGL00429:Lama4	APN	10	39011026	missense	possibly damaging	0.58
IGL00430:Lama4	APN	10	39045704	missense	possibly damaging	0.54
IGL01074:Lama4	APN	10	39098488	critical splice donor site	probably null
IGL01386:Lama4	APN	10	39011064	missense	probably benign	0.00
IGL01603:Lama4	APN	10	39065646	missense	possibly damaging	0.92
IGL01643:Lama4	APN	10	39056850	missense	probably benign
IGL01655:Lama4	APN	10	39060213	missense	probably benign
IGL01954:Lama4	APN	10	39087299	missense	probably benign	0.05
IGL01984:Lama4	APN	10	39075529	critical splice donor site	probably null
IGL02193:Lama4	APN	10	39042674	missense	probably benign
IGL02290:Lama4	APN	10	39017364	missense	probably benign	0.00
IGL02441:Lama4	APN	10	39061445	missense	probably benign	0.20
IGL02549:Lama4	APN	10	39060204	missense	probably benign	0.00
IGL02797:Lama4	APN	10	39056924	missense	probably null	0.00
IGL02819:Lama4	APN	10	39026569	missense	possibly damaging	0.80
IGL03122:Lama4	APN	10	39067963	missense	probably benign
IGL03184:Lama4	APN	10	39078843	missense	probably damaging	1.00
IGL03307:Lama4	APN	10	39017383	missense	probably benign
BB006:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
BB016:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
R0003:Lama4	UTSW	10	39060222	missense	possibly damaging	0.55
R0015:Lama4	UTSW	10	39075436	missense	possibly damaging	0.87
R0015:Lama4	UTSW	10	39075436	missense	possibly damaging	0.87
R0035:Lama4	UTSW	10	39072738	missense	probably benign	0.01
R0141:Lama4	UTSW	10	39092278	missense	probably benign	0.05
R0257:Lama4	UTSW	10	39094884	splice site	probably benign
R0267:Lama4	UTSW	10	39028639	missense	probably damaging	0.96
R0557:Lama4	UTSW	10	39088397	missense	probably benign	0.38
R1052:Lama4	UTSW	10	39092245	missense	possibly damaging	0.68
R1248:Lama4	UTSW	10	39056847	missense	probably damaging	0.99
R1249:Lama4	UTSW	10	39075478	missense	probably damaging	1.00
R1291:Lama4	UTSW	10	39048069	missense	probably benign	0.00
R1307:Lama4	UTSW	10	39070032	missense	probably benign	0.06
R1404:Lama4	UTSW	10	39061391	missense	probably benign	0.09
R1404:Lama4	UTSW	10	39061391	missense	probably benign	0.09
R1443:Lama4	UTSW	10	39073643	missense	probably damaging	1.00
R1499:Lama4	UTSW	10	39088880	missense	possibly damaging	0.92
R1616:Lama4	UTSW	10	39075450	missense	probably damaging	1.00
R1691:Lama4	UTSW	10	39080563	missense	probably benign	0.09
R1748:Lama4	UTSW	10	39065619	missense	probably benign	0.01
R1768:Lama4	UTSW	10	39103501	missense	possibly damaging	0.82
R1772:Lama4	UTSW	10	39060224	missense	probably benign	0.00
R1813:Lama4	UTSW	10	39033125	splice site	probably benign
R1813:Lama4	UTSW	10	39060186	missense	probably damaging	1.00
R1897:Lama4	UTSW	10	39060186	missense	probably damaging	1.00
R1907:Lama4	UTSW	10	39072758	missense	probably benign	0.13
R1943:Lama4	UTSW	10	39097138	missense	possibly damaging	0.85
R2041:Lama4	UTSW	10	39069991	missense	probably damaging	1.00
R2242:Lama4	UTSW	10	39026693	missense	probably damaging	1.00
R2300:Lama4	UTSW	10	39087320	missense	probably benign
R2326:Lama4	UTSW	10	39042567	splice site	probably null
R2570:Lama4	UTSW	10	39075358	missense	possibly damaging	0.94
R2570:Lama4	UTSW	10	39106047	missense	probably damaging	1.00
R2571:Lama4	UTSW	10	39042675	missense	possibly damaging	0.55
R2887:Lama4	UTSW	10	39092254	missense	possibly damaging	0.94
R2926:Lama4	UTSW	10	39078832	missense	probably benign	0.16
R3237:Lama4	UTSW	10	39097179	missense	probably damaging	0.97
R4095:Lama4	UTSW	10	39097122	missense	probably damaging	1.00
R4151:Lama4	UTSW	10	39005428	missense	probably benign	0.00
R4470:Lama4	UTSW	10	39080496	nonsense	probably null
R4812:Lama4	UTSW	10	39072769	missense	probably benign
R4822:Lama4	UTSW	10	39033053	missense	probably benign	0.01
R4997:Lama4	UTSW	10	39092266	missense	probably damaging	0.99
R5119:Lama4	UTSW	10	39048054	missense	probably benign	0.00
R5468:Lama4	UTSW	10	39072682	splice site	probably null
R5909:Lama4	UTSW	10	39072859	missense	probably benign	0.00
R5917:Lama4	UTSW	10	39048032	missense	probably benign	0.10
R5927:Lama4	UTSW	10	39072812	missense	probably damaging	1.00
R5950:Lama4	UTSW	10	39030448	missense	probably benign	0.03
R6051:Lama4	UTSW	10	39067902	missense	probably benign	0.01
R6277:Lama4	UTSW	10	39106010	missense	probably damaging	1.00
R6294:Lama4	UTSW	10	39075470	missense	probably damaging	1.00
R6372:Lama4	UTSW	10	39067952	missense	probably benign
R6532:Lama4	UTSW	10	39048077	missense	possibly damaging	0.58
R6547:Lama4	UTSW	10	39073656	missense	probably damaging	1.00
R6578:Lama4	UTSW	10	39017365	missense	probably benign	0.01
R6737:Lama4	UTSW	10	39094911	missense	probably damaging	0.96
R6987:Lama4	UTSW	10	39074279	missense	probably benign	0.00
R7040:Lama4	UTSW	10	39060162	missense	possibly damaging	0.69
R7139:Lama4	UTSW	10	39075495	missense	probably damaging	1.00
R7188:Lama4	UTSW	10	38965733	start gained	probably benign
R7189:Lama4	UTSW	10	38965733	start gained	probably benign
R7199:Lama4	UTSW	10	39080540	missense	possibly damaging	0.84
R7211:Lama4	UTSW	10	39005495	missense	probably damaging	0.98
R7262:Lama4	UTSW	10	39094934	missense	probably damaging	1.00
R7274:Lama4	UTSW	10	39092299	missense	probably benign	0.00
R7311:Lama4	UTSW	10	39026635	missense	probably damaging	1.00
R7391:Lama4	UTSW	10	39087387	critical splice donor site	probably null
R7399:Lama4	UTSW	10	39047948	missense	probably damaging	0.98
R7426:Lama4	UTSW	10	39045755	missense	possibly damaging	0.82
R7472:Lama4	UTSW	10	39087373	missense	possibly damaging	0.65
R7635:Lama4	UTSW	10	39092188	missense	probably benign
R7775:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
R7805:Lama4	UTSW	10	39026751	critical splice donor site	probably null
R7885:Lama4	UTSW	10	39088844	missense	probably benign	0.01
R7895:Lama4	UTSW	10	39088329	missense	probably damaging	0.96
R7910:Lama4	UTSW	10	39070009	missense	probably damaging	0.99
R7929:Lama4	UTSW	10	39078847	missense	probably damaging	1.00
R7952:Lama4	UTSW	10	39030490	missense	probably benign	0.39
R7991:Lama4	UTSW	10	39045809	missense	possibly damaging	0.70
R8059:Lama4	UTSW	10	38966061	missense	probably benign	0.00
R8194:Lama4	UTSW	10	39078720	missense	probably damaging	0.99
R8248:Lama4	UTSW	10	39061379	missense	possibly damaging	0.82
R8252:Lama4	UTSW	10	39060146	missense	probably benign	0.00
R8265:Lama4	UTSW	10	39105204	missense	probably damaging	1.00
R8275:Lama4	UTSW	10	39072811	missense	probably damaging	1.00
R8426:Lama4	UTSW	10	39103491	missense	probably damaging	0.98
R8434:Lama4	UTSW	10	39026707	missense	possibly damaging	0.92
R8720:Lama4	UTSW	10	39095083	missense	probably damaging	0.97
R8792:Lama4	UTSW	10	39048052	missense	probably benign	0.00
R8836:Lama4	UTSW	10	39026591	missense	probably damaging	1.00
R8867:Lama4	UTSW	10	39048000	missense	probably damaging	1.00
R8892:Lama4	UTSW	10	39097198	missense	probably damaging	1.00
R8913:Lama4	UTSW	10	39106043	missense	probably benign	0.10
R9129:Lama4	UTSW	10	39056891	missense	probably benign
R9177:Lama4	UTSW	10	39074692	missense	probably damaging	0.98
R9187:Lama4	UTSW	10	39048128	critical splice donor site	probably null
R9193:Lama4	UTSW	10	39075448	missense	probably benign	0.03
R9268:Lama4	UTSW	10	39074692	missense	probably damaging	0.98
R9287:Lama4	UTSW	10	39105964	missense	probably damaging	1.00
R9295:Lama4	UTSW	10	39072751	missense	probably damaging	1.00
R9303:Lama4	UTSW	10	39097141	missense	probably damaging	0.99
R9330:Lama4	UTSW	10	39078726	missense	probably damaging	0.99
R9430:Lama4	UTSW	10	39045806	missense	probably null
R9572:Lama4	UTSW	10	39083275	missense	probably damaging	1.00
R9636:Lama4	UTSW	10	39080504	missense	possibly damaging	0.67
R9663:Lama4	UTSW	10	39047948	missense	probably damaging	0.98
R9777:Lama4	UTSW	10	39048105	missense	probably benign	0.00
X0067:Lama4	UTSW	10	39045692	missense	probably benign	0.00
Z1177:Lama4	UTSW	10	39005424	nonsense	probably null
Z1177:Lama4	UTSW	10	39005425	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGTTCATGTCAGAGGGACCG -3'
(R):5'- TGTATTGCAGGCCTGGCATTTAC -3'

Sequencing Primer
(F):5'- GGTGGGTCCCCTCTGATC -3'
(R):5'- AGGCCTGGCATTTACACAACTTTAC -3'

Posted On

2019-06-07