Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4585001:Sim1'

556613

Institutional Source

Beutler Lab

Gene Symbol

Sim1

Ensembl Gene

ENSMUSG00000019913

Gene Name

single-minded family bHLH transcription factor 1

Synonyms

bHLHe14

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4585001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

50894754-50989152 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 50984188 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 715 (Y715*)

Ref Sequence

ENSEMBL: ENSMUSP00000020071 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020071]

Predicted Effect

probably null
Transcript: ENSMUST00000020071
AA Change: Y715*

SMART Domains

Protein: ENSMUSP00000020071
Gene: ENSMUSG00000019913
AA Change: Y715*

Domain	Start	End	E-Value	Type
HLH	6	59	8.73e-6	SMART
PAS	79	145	7.39e-14	SMART
PAS	220	286	5.61e-5	SMART
PAC	292	335	4.63e-6	SMART
Pfam:SIM_C	359	668	2.5e-114	PFAM

Coding Region Coverage

1x: 93.6%
3x: 91.2%
10x: 86.5%
20x: 76.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIM1 and SIM2 genes are Drosophila single-minded (sim) gene homologs. SIM1 transcript was detected only in fetal kidney out of various adult and fetal tissues tested. Since the sim gene plays an important role in Drosophila development and has peak levels of expression during the period of neurogenesis,it was proposed that the human SIM gene is a candidate for involvement in certain dysmorphic features (particularly the facial and skull characteristics), abnormalities of brain development, and/or mental retardation of Down syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with abnormalities in the paraventricular and supraoptic nuclei. Heterozygous mutant mice are obese and may also be diabetic, hyperinsulinemic and insulin resistant. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aurka	T	C	2: 172,357,197	M318V	probably benign	Het
Cacna2d1	T	A	5: 16,326,344	D560E	probably damaging	Het
Ccdc148	T	A	2: 58,982,976	T202S	probably benign	Het
Ccdc155	C	T	7: 45,200,271	G76D	probably benign	Het
Cdc42bpb	T	C	12: 111,304,978	D1149G	probably damaging	Het
Clasp1	T	A	1: 118,462,555	N156K	probably damaging	Het
Cox18	G	A	5: 90,217,575	T255I	possibly damaging	Het
Cse1l	A	G	2: 166,941,474	T783A	probably damaging	Het
Dnajc16	T	C	4: 141,764,685	Y609C	probably damaging	Het
Doc2g	A	G	19: 4,006,630	T339A	probably benign	Het
Eif5a	T	C	11: 69,918,070		probably benign	Het
Epha3	A	G	16: 63,566,577		probably null	Het
Esco1	A	T	18: 10,594,355	C310*	probably null	Het
Fam208b	G	A	13: 3,574,979	A1657V	possibly damaging	Het
Fam222a	A	G	5: 114,611,040	Y99C	probably damaging	Het
Fzd2	T	C	11: 102,605,747	L339P	probably damaging	Het
Gfral	A	T	9: 76,197,294	N145K	probably damaging	Het
Gga1	T	A	15: 78,893,790	N618K	probably benign	Het
Gpatch3	T	A	4: 133,583,086	H447Q	probably damaging	Het
Gpn1	A	T	5: 31,509,403	R346*	probably null	Het
Gsg1	T	C	6: 135,237,560	E317G	probably benign	Het
Gsk3b	A	G	16: 38,184,454	N129S	probably damaging	Het
Hmg20b	G	T	10: 81,348,955	D94E	possibly damaging	Het
Klhdc9	T	A	1: 171,359,818	H204L	possibly damaging	Het
Klhl24	A	G	16: 20,106,888	I55M	probably benign	Het
Kmt2c	T	C	5: 25,315,106	D2002G	probably benign	Het
Lama4	A	G	10: 39,074,746	N1015S	probably damaging	Het
Lpp	T	C	16: 24,761,947	C263R	probably benign	Het
Lrp1b	T	C	2: 41,269,204	I1689V		Het
Mipep	C	A	14: 60,784,835	Q50K	probably benign	Het
Mx1	T	C	16: 97,456,254	D101G	probably benign	Het
Nabp2	C	G	10: 128,408,807	E37Q	possibly damaging	Het
Nme6	A	G	9: 109,842,036	I115V	possibly damaging	Het
Nup93	A	T	8: 94,243,727	T85S	probably benign	Het
Oit3	T	A	10: 59,431,013	I224F	possibly damaging	Het
Parp14	T	C	16: 35,858,605	K331R	probably benign	Het
Pls1	T	A	9: 95,761,390	T519S	probably benign	Het
Rcn3	A	G	7: 45,086,694	F197L	probably benign	Het
Rnf213	C	T	11: 119,458,392	T3773I		Het
Rprd1b	A	T	2: 158,047,957	I153L	probably benign	Het
Scel	A	G	14: 103,592,368	D462G	possibly damaging	Het
Sh3bp1	C	T	15: 78,910,076	S548L	possibly damaging	Het
Slc18a2	A	T	19: 59,293,861	Q500L	possibly damaging	Het
Slc5a8	T	G	10: 88,886,503	M66R	probably damaging	Het
Slco1a6	T	C	6: 142,109,520	T233A	probably damaging	Het
Smu1	T	C	4: 40,739,623	T396A	probably benign	Het
Tas2r104	T	C	6: 131,685,558	T63A	possibly damaging	Het
Top2a	C	T	11: 99,001,373	A1088T	probably benign	Het
Ucp1	T	C	8: 83,293,948	F129S	probably damaging	Het
Unc13b	T	A	4: 43,091,298	D41E	probably benign	Het
Usp10	T	G	8: 119,954,892	V696G	probably benign	Het
Xylt2	C	T	11: 94,666,240	V745M	probably damaging	Het
Zbtb49	A	T	5: 38,216,476	N41K	probably damaging	Het
Zfp109	T	A	7: 24,229,354	D218V	probably benign	Het
Zfp420	G	A	7: 29,876,005	R550Q	probably benign	Het

Other mutations in Sim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Sim1	APN	10	50981534	missense	probably damaging	0.99
IGL01142:Sim1	APN	10	50910671	missense	probably damaging	0.99
IGL01886:Sim1	APN	10	50984315	missense	probably damaging	1.00
R0128:Sim1	UTSW	10	50907961	missense	probably damaging	1.00
R0130:Sim1	UTSW	10	50907961	missense	probably damaging	1.00
R0717:Sim1	UTSW	10	50909828	missense	probably damaging	1.00
R0948:Sim1	UTSW	10	50981327	nonsense	probably null
R1169:Sim1	UTSW	10	50981522	missense	probably benign	0.13
R1388:Sim1	UTSW	10	50895994	missense	probably damaging	1.00
R1746:Sim1	UTSW	10	50984109	missense	probably benign
R1778:Sim1	UTSW	10	50981553	nonsense	probably null
R1834:Sim1	UTSW	10	50909828	missense	probably damaging	1.00
R2434:Sim1	UTSW	10	50907958	missense	probably damaging	1.00
R2919:Sim1	UTSW	10	50909815	missense	probably benign	0.23
R3617:Sim1	UTSW	10	50909528	missense	probably damaging	1.00
R3625:Sim1	UTSW	10	50981336	missense	probably benign	0.30
R4152:Sim1	UTSW	10	50983854	missense	probably damaging	0.98
R4414:Sim1	UTSW	10	50981612	missense	probably benign	0.13
R4645:Sim1	UTSW	10	50983997	missense	probably benign	0.13
R4781:Sim1	UTSW	10	50983785	missense	probably benign	0.08
R4889:Sim1	UTSW	10	50981324	missense	probably benign	0.05
R4924:Sim1	UTSW	10	50909902	missense	probably damaging	1.00
R6625:Sim1	UTSW	10	50983986	missense	probably benign
R6783:Sim1	UTSW	10	50908727	missense	possibly damaging	0.72
R6876:Sim1	UTSW	10	50983695	missense	possibly damaging	0.77
R6909:Sim1	UTSW	10	50909410	missense	possibly damaging	0.92
R6924:Sim1	UTSW	10	50908539	missense	probably benign	0.10
R7016:Sim1	UTSW	10	50984250	missense	probably benign	0.03
R7135:Sim1	UTSW	10	50895927	missense	probably damaging	0.99
R7149:Sim1	UTSW	10	50909540	missense	probably damaging	1.00
R7300:Sim1	UTSW	10	50909518	missense	probably benign	0.23
R7750:Sim1	UTSW	10	50896035	missense	possibly damaging	0.94
R7973:Sim1	UTSW	10	50981323	missense	probably damaging	1.00
R8087:Sim1	UTSW	10	50909555	missense	possibly damaging	0.95
Z1177:Sim1	UTSW	10	50984328	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- AGTAGTCCTAGTTCTGATCGCATTAC -3'
(R):5'- GGCATAGTAAATGTTGCTAATGGGG -3'

Sequencing Primer
(F):5'- CCTAGTTCTGATCGCATTACAAAGTC -3'
(R):5'- TGTTTCAGAGACCCTTGAAGAAC -3'

Posted On

2019-06-07