Incidental Mutation 'PIT4585001:Oit3'
ID 556614
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Name oncoprotein induced transcript 3
Synonyms EF-9
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.420) question?
Stock # PIT4585001 (G1)
Quality Score 168.009
Status Not validated
Chromosome 10
Chromosomal Location 59258782-59277601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59266835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 224 (I224F)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
AlphaFold Q8R4V5
Predicted Effect possibly damaging
Transcript: ENSMUST00000009798
AA Change: I224F

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: I224F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,199,117 (GRCm39) M318V probably benign Het
Cacna2d1 T A 5: 16,531,342 (GRCm39) D560E probably damaging Het
Ccdc148 T A 2: 58,872,988 (GRCm39) T202S probably benign Het
Cdc42bpb T C 12: 111,271,412 (GRCm39) D1149G probably damaging Het
Clasp1 T A 1: 118,390,285 (GRCm39) N156K probably damaging Het
Cox18 G A 5: 90,365,434 (GRCm39) T255I possibly damaging Het
Cse1l A G 2: 166,783,394 (GRCm39) T783A probably damaging Het
Dnajc16 T C 4: 141,491,996 (GRCm39) Y609C probably damaging Het
Doc2g A G 19: 4,056,630 (GRCm39) T339A probably benign Het
Eif5a T C 11: 69,808,896 (GRCm39) probably benign Het
Epha3 A G 16: 63,386,940 (GRCm39) probably null Het
Esco1 A T 18: 10,594,355 (GRCm39) C310* probably null Het
Fam222a A G 5: 114,749,101 (GRCm39) Y99C probably damaging Het
Fzd2 T C 11: 102,496,573 (GRCm39) L339P probably damaging Het
Gfral A T 9: 76,104,576 (GRCm39) N145K probably damaging Het
Gga1 T A 15: 78,777,990 (GRCm39) N618K probably benign Het
Gpatch3 T A 4: 133,310,397 (GRCm39) H447Q probably damaging Het
Gpn1 A T 5: 31,666,747 (GRCm39) R346* probably null Het
Gsg1 T C 6: 135,214,558 (GRCm39) E317G probably benign Het
Gsk3b A G 16: 38,004,816 (GRCm39) N129S probably damaging Het
Hmg20b G T 10: 81,184,789 (GRCm39) D94E possibly damaging Het
Kash5 C T 7: 44,849,695 (GRCm39) G76D probably benign Het
Klhdc9 T A 1: 171,187,386 (GRCm39) H204L possibly damaging Het
Klhl24 A G 16: 19,925,638 (GRCm39) I55M probably benign Het
Kmt2c T C 5: 25,520,104 (GRCm39) D2002G probably benign Het
Lama4 A G 10: 38,950,742 (GRCm39) N1015S probably damaging Het
Lpp T C 16: 24,580,697 (GRCm39) C263R probably benign Het
Lrp1b T C 2: 41,159,216 (GRCm39) I1689V Het
Mipep C A 14: 61,022,284 (GRCm39) Q50K probably benign Het
Mx1 T C 16: 97,257,454 (GRCm39) D101G probably benign Het
Nabp2 C G 10: 128,244,676 (GRCm39) E37Q possibly damaging Het
Nme6 A G 9: 109,671,104 (GRCm39) I115V possibly damaging Het
Nup93 A T 8: 94,970,355 (GRCm39) T85S probably benign Het
Parp14 T C 16: 35,678,975 (GRCm39) K331R probably benign Het
Pls1 T A 9: 95,643,443 (GRCm39) T519S probably benign Het
Rcn3 A G 7: 44,736,118 (GRCm39) F197L probably benign Het
Rnf213 C T 11: 119,349,218 (GRCm39) T3773I Het
Rprd1b A T 2: 157,889,877 (GRCm39) I153L probably benign Het
Scel A G 14: 103,829,804 (GRCm39) D462G possibly damaging Het
Sh3bp1 C T 15: 78,794,276 (GRCm39) S548L possibly damaging Het
Sim1 T A 10: 50,860,284 (GRCm39) Y715* probably null Het
Slc18a2 A T 19: 59,282,293 (GRCm39) Q500L possibly damaging Het
Slc5a8 T G 10: 88,722,365 (GRCm39) M66R probably damaging Het
Slco1a6 T C 6: 142,055,246 (GRCm39) T233A probably damaging Het
Smu1 T C 4: 40,739,623 (GRCm39) T396A probably benign Het
Tas2r104 T C 6: 131,662,521 (GRCm39) T63A possibly damaging Het
Tasor2 G A 13: 3,624,979 (GRCm39) A1657V possibly damaging Het
Top2a C T 11: 98,892,199 (GRCm39) A1088T probably benign Het
Ucp1 T C 8: 84,020,577 (GRCm39) F129S probably damaging Het
Unc13b T A 4: 43,091,298 (GRCm39) D41E probably benign Het
Usp10 T G 8: 120,681,631 (GRCm39) V696G probably benign Het
Xylt2 C T 11: 94,557,066 (GRCm39) V745M probably damaging Het
Zbtb49 A T 5: 38,373,820 (GRCm39) N41K probably damaging Het
Zfp109 T A 7: 23,928,779 (GRCm39) D218V probably benign Het
Zfp420 G A 7: 29,575,430 (GRCm39) R550Q probably benign Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59,261,306 (GRCm39) unclassified probably benign
IGL01665:Oit3 APN 10 59,274,731 (GRCm39) missense probably damaging 1.00
IGL01839:Oit3 APN 10 59,265,318 (GRCm39) missense probably damaging 0.98
IGL02028:Oit3 APN 10 59,274,477 (GRCm39) missense probably damaging 0.98
R0567:Oit3 UTSW 10 59,271,800 (GRCm39) missense probably damaging 0.99
R0781:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1110:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1563:Oit3 UTSW 10 59,263,896 (GRCm39) missense probably damaging 1.00
R1623:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 0.99
R1693:Oit3 UTSW 10 59,261,239 (GRCm39) missense probably damaging 1.00
R1754:Oit3 UTSW 10 59,263,762 (GRCm39) splice site probably null
R1853:Oit3 UTSW 10 59,277,444 (GRCm39) critical splice donor site probably null
R2070:Oit3 UTSW 10 59,266,835 (GRCm39) missense probably benign 0.03
R2211:Oit3 UTSW 10 59,263,892 (GRCm39) missense probably damaging 1.00
R2516:Oit3 UTSW 10 59,277,507 (GRCm39) start gained probably benign
R2516:Oit3 UTSW 10 59,264,167 (GRCm39) missense probably damaging 1.00
R3103:Oit3 UTSW 10 59,274,713 (GRCm39) missense probably damaging 0.98
R4414:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4415:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4416:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4417:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4584:Oit3 UTSW 10 59,261,284 (GRCm39) missense probably damaging 1.00
R4734:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4748:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4749:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R5070:Oit3 UTSW 10 59,259,849 (GRCm39) missense probably damaging 1.00
R5521:Oit3 UTSW 10 59,271,736 (GRCm39) missense probably benign
R6326:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 1.00
R6490:Oit3 UTSW 10 59,274,374 (GRCm39) missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59,265,462 (GRCm39) missense probably damaging 1.00
R6766:Oit3 UTSW 10 59,274,534 (GRCm39) missense probably damaging 0.99
R6921:Oit3 UTSW 10 59,271,767 (GRCm39) missense probably damaging 0.99
R7129:Oit3 UTSW 10 59,264,166 (GRCm39) missense probably damaging 0.99
R7440:Oit3 UTSW 10 59,265,392 (GRCm39) missense probably damaging 0.99
R7495:Oit3 UTSW 10 59,259,765 (GRCm39) missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59,274,716 (GRCm39) missense probably damaging 1.00
R7866:Oit3 UTSW 10 59,259,852 (GRCm39) missense probably benign 0.03
R8312:Oit3 UTSW 10 59,274,632 (GRCm39) missense probably benign 0.01
R8321:Oit3 UTSW 10 59,263,982 (GRCm39) missense probably benign 0.00
R8919:Oit3 UTSW 10 59,277,468 (GRCm39) missense unknown
R9131:Oit3 UTSW 10 59,271,751 (GRCm39) missense probably benign 0.01
R9457:Oit3 UTSW 10 59,277,505 (GRCm39) start codon destroyed unknown
R9478:Oit3 UTSW 10 59,274,464 (GRCm39) missense probably damaging 0.99
R9502:Oit3 UTSW 10 59,264,173 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGACTGCTGACTCAGG -3'
(R):5'- AGGACGGTGCATTACTCTTGG -3'

Sequencing Primer
(F):5'- TGCTGACTCAGGGGACACTTG -3'
(R):5'- GGTGCATTACTCTTGGCAGTCATAAC -3'
Posted On 2019-06-07