Incidental Mutation 'PIT4585001:Oit3'
ID556614
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Nameoncoprotein induced transcript 3
SynonymsEF-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #PIT4585001 (G1)
Quality Score168.009
Status Not validated
Chromosome10
Chromosomal Location59422958-59441778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59431013 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 224 (I224F)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009798
AA Change: I224F

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: I224F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Coding Region Coverage
  • 1x: 93.6%
  • 3x: 91.2%
  • 10x: 86.5%
  • 20x: 76.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aurka T C 2: 172,357,197 M318V probably benign Het
Cacna2d1 T A 5: 16,326,344 D560E probably damaging Het
Ccdc148 T A 2: 58,982,976 T202S probably benign Het
Ccdc155 C T 7: 45,200,271 G76D probably benign Het
Cdc42bpb T C 12: 111,304,978 D1149G probably damaging Het
Clasp1 T A 1: 118,462,555 N156K probably damaging Het
Cox18 G A 5: 90,217,575 T255I possibly damaging Het
Cse1l A G 2: 166,941,474 T783A probably damaging Het
Dnajc16 T C 4: 141,764,685 Y609C probably damaging Het
Doc2g A G 19: 4,006,630 T339A probably benign Het
Eif5a T C 11: 69,918,070 probably benign Het
Epha3 A G 16: 63,566,577 probably null Het
Esco1 A T 18: 10,594,355 C310* probably null Het
Fam208b G A 13: 3,574,979 A1657V possibly damaging Het
Fam222a A G 5: 114,611,040 Y99C probably damaging Het
Fzd2 T C 11: 102,605,747 L339P probably damaging Het
Gfral A T 9: 76,197,294 N145K probably damaging Het
Gga1 T A 15: 78,893,790 N618K probably benign Het
Gpatch3 T A 4: 133,583,086 H447Q probably damaging Het
Gpn1 A T 5: 31,509,403 R346* probably null Het
Gsg1 T C 6: 135,237,560 E317G probably benign Het
Gsk3b A G 16: 38,184,454 N129S probably damaging Het
Hmg20b G T 10: 81,348,955 D94E possibly damaging Het
Klhdc9 T A 1: 171,359,818 H204L possibly damaging Het
Klhl24 A G 16: 20,106,888 I55M probably benign Het
Kmt2c T C 5: 25,315,106 D2002G probably benign Het
Lama4 A G 10: 39,074,746 N1015S probably damaging Het
Lpp T C 16: 24,761,947 C263R probably benign Het
Lrp1b T C 2: 41,269,204 I1689V Het
Mipep C A 14: 60,784,835 Q50K probably benign Het
Mx1 T C 16: 97,456,254 D101G probably benign Het
Nabp2 C G 10: 128,408,807 E37Q possibly damaging Het
Nme6 A G 9: 109,842,036 I115V possibly damaging Het
Nup93 A T 8: 94,243,727 T85S probably benign Het
Parp14 T C 16: 35,858,605 K331R probably benign Het
Pls1 T A 9: 95,761,390 T519S probably benign Het
Rcn3 A G 7: 45,086,694 F197L probably benign Het
Rnf213 C T 11: 119,458,392 T3773I Het
Rprd1b A T 2: 158,047,957 I153L probably benign Het
Scel A G 14: 103,592,368 D462G possibly damaging Het
Sh3bp1 C T 15: 78,910,076 S548L possibly damaging Het
Sim1 T A 10: 50,984,188 Y715* probably null Het
Slc18a2 A T 19: 59,293,861 Q500L possibly damaging Het
Slc5a8 T G 10: 88,886,503 M66R probably damaging Het
Slco1a6 T C 6: 142,109,520 T233A probably damaging Het
Smu1 T C 4: 40,739,623 T396A probably benign Het
Tas2r104 T C 6: 131,685,558 T63A possibly damaging Het
Top2a C T 11: 99,001,373 A1088T probably benign Het
Ucp1 T C 8: 83,293,948 F129S probably damaging Het
Unc13b T A 4: 43,091,298 D41E probably benign Het
Usp10 T G 8: 119,954,892 V696G probably benign Het
Xylt2 C T 11: 94,666,240 V745M probably damaging Het
Zbtb49 A T 5: 38,216,476 N41K probably damaging Het
Zfp109 T A 7: 24,229,354 D218V probably benign Het
Zfp420 G A 7: 29,876,005 R550Q probably benign Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59425484 unclassified probably benign
IGL01665:Oit3 APN 10 59438909 missense probably damaging 1.00
IGL01839:Oit3 APN 10 59429496 missense probably damaging 0.98
IGL02028:Oit3 APN 10 59438655 missense probably damaging 0.98
R0567:Oit3 UTSW 10 59435978 missense probably damaging 0.99
R0781:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1110:Oit3 UTSW 10 59428194 missense probably damaging 1.00
R1563:Oit3 UTSW 10 59428074 missense probably damaging 1.00
R1623:Oit3 UTSW 10 59428239 missense probably damaging 0.99
R1693:Oit3 UTSW 10 59425417 missense probably damaging 1.00
R1754:Oit3 UTSW 10 59427940 splice site probably null
R1853:Oit3 UTSW 10 59441622 critical splice donor site probably null
R2070:Oit3 UTSW 10 59431013 missense probably benign 0.03
R2211:Oit3 UTSW 10 59428070 missense probably damaging 1.00
R2516:Oit3 UTSW 10 59428345 missense probably damaging 1.00
R2516:Oit3 UTSW 10 59441685 start gained probably benign
R3103:Oit3 UTSW 10 59438891 missense probably damaging 0.98
R4414:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4415:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4416:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4417:Oit3 UTSW 10 59428103 missense probably damaging 1.00
R4584:Oit3 UTSW 10 59425462 missense probably damaging 1.00
R4734:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4748:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R4749:Oit3 UTSW 10 59424082 missense probably damaging 0.99
R5070:Oit3 UTSW 10 59424027 missense probably damaging 1.00
R5521:Oit3 UTSW 10 59435914 missense probably benign
R6326:Oit3 UTSW 10 59428239 missense probably damaging 1.00
R6490:Oit3 UTSW 10 59438552 missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59429640 missense probably damaging 1.00
R6766:Oit3 UTSW 10 59438712 missense probably damaging 0.99
R6921:Oit3 UTSW 10 59435945 missense probably damaging 0.99
R7129:Oit3 UTSW 10 59428344 missense probably damaging 0.99
R7440:Oit3 UTSW 10 59429570 missense probably damaging 0.99
R7495:Oit3 UTSW 10 59423943 missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59438894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGACTGCTGACTCAGG -3'
(R):5'- AGGACGGTGCATTACTCTTGG -3'

Sequencing Primer
(F):5'- TGCTGACTCAGGGGACACTTG -3'
(R):5'- GGTGCATTACTCTTGGCAGTCATAAC -3'
Posted On2019-06-07